Akap10 (BC054105) Mouse Untagged Clone

CAT#: MC218334

Akap10 (untagged) - Mouse A kinase (PRKA) anchor protein 10 (cDNA clone MGC:60489 IMAGE:30022728), (10ug)


  "BC054105" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Akap10"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Akap10
Synonyms 1500031L16Rik; B130049N18Rik; D-AKAP-2; D-AKAP2; PRKA10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC054105
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAAGTATAGAACAAGATGCAGTGAATACTTTTACCAAATATATATCTCCAGATGCTGCTAAGCCAA
TACCAATTACAGAAGCCATGAGAAACGACATCATCGCAAAGATTTGTGGAGAAGATGGACAGGTGGATCC
CAACTGTTTCGTTCTGGCACAGGCTGTAGTCTTTAGTGCAATGGAGCAAGAGCACTTTAGTGAGTTTCTG
CGAAGTCACCATTTCTGTAAATACCAGATTGAAGTGCTGACCAGTGGGACTGTTTACCTGGCTGATATCC
TCTTCTGTGAGTCAGCCCTCTTTTATTTTTCTGAGTACATGGAAAAAGAAGATGCAGTGAATGTCTTACA
ATTCTGGTTAGCAGCGGATAATTTCCAGTCTCAGCTTGCTGCCAAAAAGGGCCAGTATGATGGACAGGAG
GCCCAGAATGATGCCATGATTTTATATGACAAGTACTTTTCCCTCCAAGCCACACACCCCCTTGGATTTG
ATGATGTTGTACGATTAGAAATTGAATCTAATATCTGCAGGGAAGGTGGACCACTTCCTAATTGTTTCAC
AACTCCATTACGTCAGGCCTGGACAACCATGGAGAAGGTCTTTTTGCCTGGTTTTCTGTCCAGCAATCTT
TATTACAAATATTTGAATGATCTCATCCATTCAGTTCGAGGAGATGAATTTCTTGGAGGGAATGTTTCCC
TGGCTGCTCACGGCTCTGTCTGCCTTCCTGAGGAGTCTCACTCAGGTGGTTCCGATGGCTCCACTGCTCA
GTCTAGTGTGAAAAAAGCCAGTATTAAAATTCTGAAAAATTTTGATGAAGCAATAATTGTGGATGCTGCA
AGTCTGGACCCAGAATCTTTATATCAACGGACATATGCAGGGAAGATGTCCTTTGGGAGAGTTAGTGATT
TGGGGCAGTTCATCCGAGAGTCTGAGCCTGAACCTGATGTGAAGAAATCAAAAGGATTTATGTTCTCACA
AGCTATGAAGAAGTGGGTGCAAGGAAATACTGACGAGGCCCAAGAAGAGCTAGCTTGGAAGATTGCAAAA
ATGATAGTGAGTGATGTTATGCAGCCGGCACACCATGATCAACCACTAGAGAAGTCTACAAAGCTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC054105
Insert Size 1119 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC054105, AAH54105
RefSeq Size 2836 bp
RefSeq ORF 1118 bp
Locus ID 56697
Cytogenetics 11 B2
Gene Summary This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is localized to mitochondria and interacts with both the type I and type II regulatory subunits of PKA. It has been reported that this protein is important for maintaining heart rate and myocardial contractility through its targeting of protein kinase A. In mouse, defects of this gene lead to cardiac arrhythmias and premature death. In humans, polymorphisms in this gene may be associated with increased risk of arrhythmias and sudden cardiac death. [provided by RefSeq, May 2013]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.