Map2k7 (NM_001164172) Mouse Untagged Clone

CAT#: MC218283

Map2k7 (untagged) - Mouse mitogen-activated protein kinase kinase 7 (Map2k7), transcript variant 3, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Map2k7
• Synonyms: 5930412N11Rik; JNKK 2; Jnkk2; MAPKK 7; Mapkk7; MEK 7; Mek7; Mkk7; Prkmk7; sek2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC218283 representing NM_001164172
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGGCGTCCTCCCTGGAGCAGAAGCTGTCCCGCCTGGAAGCCAAGCTGAAGCAGGAGAACCGTGAGG
  CCCGCAGGAGGATCGACCTCAACTTGGATATCAGCCCACAGCGGCCCAGGCCCATTATTGTGATCACTCT
  AAGCCCTGCTCCTGCCCCGTCCCAGCGAGCAGCCCTGCAACTCCCACTGGCCAACGATGGGGGCAGCCGC
  TCACCATCCTCAGAGAGCTCCCCACAGCACCCTACACCCCCCACCCGGCCCCGCCACATGCTGGGGCTCC
  CATCAACCTTGTTCACACCGCGCAGTATGGAGAGCATCGAGATTGACCAGAAGCTGCAGGAGATCATGAA
  GCAGACAGGGTACCTGACTATCGGGGGCCAGCGTTATCAGGCAGAAATCAATGACTTGGAGAACTTGGGT
  GAGATGGGCAGTGGTACCTGTGGTCAGGTGTGGAAGATGCGGTTCCGGAAGACAGGCCACATCATTGCTG
  TTAAGCAAATGCGGCGCTCTGGGAACAAGGAAGAGAATAAGCGCATTTTGATGGACCTGGATGTAGTACT
  CAAGAGCCATGACTGCCCTTACATCGTTCAGTGCTTTGGCACCTTCATCACCAACACAGACGTCTTTATT
  GCCATGGAGCTCATGGGCACATGTGCAGAGAAGCTGAAGAAACGAATGCAGGGCCCCATTCCAGAGCGAA
  TCCTGGGCAAGATGACTGTGGCGATTGTGAAAGCACTGTACTATCTGAAGGAGAAGCATGGCGTCATCCA
  TCGCGATGTCAAACCCTCCAACATCCTGCTAGATGAGCGGGGCCAGATCAAGCTCTGTGACTTTGGCATC
  AGTGGCCGCCTTGTTGACTCCAAAGCCAAAACACGGAGTGCTGGCTGTGCTGCCTATATGGCTCCCGAGC
  GCATCGACCCTCCAGATCCCACCAAGCCTGACTATGACATCCGAGCTGATGTGTGGAGCCTGGGCATCTC
  ACTGGTGGAGCTGGCAACAGGACAGTTCCCCTATAAGAACTGCAAGACGGACTTTGAGGTCCTCACCAAA
  GTCCTACAGGAAGAGCCCCCACTCCTGCCTGGTCACATGGGCTTCTCAGGGGACTTCCAGTCATTTGTCA
  AAGACTGCCTTACTAAAGATCACAGGAAGAGACCAAAGTATAATAAGCTACTTGAACACAGCTTCATCAA
  GCACTATGAGATACTCGAGGTGGATGTCGCGTCCTGGTTTAAGGATGTCATGGCGAAGACCGAGTCCCCA
  AGGACTAGTGGAGTCCTGAGTCAGCACCATCTGCCCTTCTTCAGGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001164172
• Insert Size: 1308 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001164172.1, NP_001157644.1
• RefSeq Size: 3556 bp
• RefSeq ORF: 1308 bp
• Locus ID: 26400
• UniProt ID: Q8CE90
• Cytogenetics: 8 A1.1
• Gene Summary: Dual specificity protein kinase which acts as an essential component of the MAP kinase signal transduction pathway. Essential component of the stress-activated protein kinase/c-Jun N-terminal kinase (SAP/JNK) signaling pathway. With MAP2K4/MKK4, is the one of the only known kinase to directly activate the stress-activated protein kinase/c-Jun N-terminal kinases MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. MAP2K4/MKK4 and MAP2K7/MKK7 both activate the JNKs by phosphorylation, but they differ in their preference for the phosphorylation site in the Thr-Pro-Tyr motif. MAP2K4/MKK4 shows preference for phosphorylation of the Tyr residue and MAP2K7/MKK7 for the Thr residue. The monophosphorylation of JNKs on the Thr residue is sufficient to increase JNK activity indicating that MAP2K7/MKK7 is important to trigger JNK activity, while the additional phosphorylation of the Tyr residue by MAP2K4/MKK4 ensures optimal JNK activation. Has a specific role in JNK signal transduction pathway activated by proinflammatory cytokines. The MKK/JNK signaling pathway is also involved in mitochondrial death signaling pathway, including the release cytochrome c, leading to apoptosis. Part of a non-canonical MAPK signaling pathway, composed of the upstream MAP3K12 kinase and downstream MAP kinases MAPK1/ERK2 and MAPK3/ERK1, that enhances the AP-1-mediated transcription of APP in response to APOE (PubMed:28111074).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) retains the last intron compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.