Klc1 (NM_008450) Mouse Untagged Clone

CAT#: MC218194

Klc1 (untagged) - Mouse kinesin light chain 1 (Klc1), transcript variant a, (10ug)

USD 691


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Klc1 (NM_008450) Mouse Untagged Clone
Symbol Klc1
Synonyms AI874768; Kns2
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC218194 representing NM_008450
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTATGACAACATGTCCACCATGGTGTACATAAAGGAAGAGAAGCTGGAGAAGCTCACGCAGGATGAGA
TCATCTCTAAGACCAAGCAAGTGATCCAGGGGCTGGAAGCCCTGAAGAATGAGCACAACTCCATCCTGCA
GAGTTTGCTGGAGACGCTGAAGTGCTTGAAGAAGGATGACGAGAGCAACCTGGTGGAAGAGAAATCCAGC
ATGATCCGCAAGTCCCTGGAGATGCTGGAGCTTGGCCTGAGCGAGGCGCAGGTGATGATGGCGCTGTCCA
ATCACCTGAATGCTGTGGAGTCCGAGAAGCAAAAGCTCCGCGCTCAGGTTCGACGGCTGTGCCAGGAGAA
CCAGTGGCTGCGGGATGAGCTGGCCAACACGCAGCAGAAGTTGCAGAAGAGCGAGCAGTCGGTGGCGCAG
CTGGAGGAGGAGAAGAAACACCTGGAGTTCATGAACCAGCTGAAGAAGTACGACGACGACATCTCCCCCT
CGGAGGACAAAGACTCTGATTCTTCCAAAGAGCCGTTGGATGATCTCTTCCCAAATGACGAGGACGAACC
AGGACAAGGAATCCAGCAGCAGCACAGTAGTGCTGCGGCCGCCGCCCAGCAGGGCGGCTACGAGATCCCT
GCAAGGCTGCGCACGCTCCACAACTTGGTGATCCAGTATGCTTCACAGGGGCGTTACGAGGTGGCGGTGC
CACTCTGCAAGCAGGCCCTGGAGGATCTGGAGAAGACTTCCGGCCACGACCACCCCGATGTGGCTACCAT
GCTCAACATCTTGGCCCTGGTGTACAGGGATCAGAACAAGTATAAAGATGCAGCTAACCTCCTGAACGAC
GCCCTGGCTATCCGCGAGAAAACCCTGGGCAGAGATCACCCCGCGGTGGCAGCGACTCTGAACAACCTAG
CAGTACTGTACGGTAAGCGAGGGAAGTACAAGGAGGCGGAGCCGCTGTGTAAACGAGCCCTGGAGATCAG
GGAGAAGGTTCTGGGAAAGGATCATCCTGATGTTGCCAAACAGTTAAATAACCTGGCCCTGCTGTGCCAG
AACCAGGGCAAGTACGAGGAGGTGGAGTATTATTACCAGAGGGCCCTGGGCATCTACCAGACGAAGCTGG
GGCCCGACGATCCCAACGTGGCCAAGACCAAGAACAACCTGGCCTCCTGTTATCTGAAACAAGGGAAGTT
CAAGCAGGCAGAAACGCTGTACAAGGAGATTCTCACCCGCGCACACGAGCGGGAGTTTGGATCTGTGGAC
GACGAGAACAAGCCCATCTGGATGCACGCTGAAGAGAGAGAGGAGTGCAAAGGCAAGCAGAAGGACGGGT
CGGCTTTTGGAGAGTATGGCGGCTGGTATAAAGCCTGCAAAGTGGACAGTCCCACCGTCACAACCACCTT
GAAAAACCTTGGAGCACTTTACCGACGGCAGGGGAAGTTTGAAGCTGCAGAGACATTGGAAGAAGCCGCC
ATGAGGTCACGTAAGCAGGGTCTTGACAATGTTCACAAACAGAGAGTGGCTGAAGTGCTAAATGACCCTG
AGAGCATGGAGAAGCGGAGGAGCCGGGAGAGTCTCAATATGGACGTGGTCAAGTACGAGAGTGGCCCTGA
CGGAGGGGAGGAAGCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_008450
ORF Size 1629 bp
Insert Size 1629
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_008450.2, NP_032476
RefSeq Size 2398
RefSeq ORF 1629
Locus ID 16593
Cytogenetics 12 F1|12 61.13 cM
Gene Summary Conventional kinesin is a tetrameric molecule composed of two heavy chains and two light chains, and transports various cargos along microtubules toward their plus ends. The heavy chains provide the motor activity, while the light chains bind to various cargos. This gene encodes a member of the kinesin light chain family. It associates with kinesin heavy chain through an N-terminal domain, and six tetratricopeptide repeat (TPR) motifs are thought to be involved in binding of cargos such as vesicles, mitochondria, and the Golgi complex. Thus, kinesin light chains function as adapter molecules and not motors per se. Although previously named 'kinesin 2', this gene is not a member of the kinesin-2 / kinesin heavy chain subfamily of kinesin motor proteins. Extensive alternative splicing produces isoforms with different C-termini that are proposed to bind to different cargos; however, the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.