Jak1 (BC031297) Mouse Untagged Clone

CAT#: MC218193

Reviews ()
Write a review

Jak1 (untagged) - Mouse Janus kinase 1 (cDNA clone MGC:37919 IMAGE:5102798), (10ug)

  View "BC031297" in other vectors (6)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 710.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Jak1 (BC031297) Mouse Untagged Clone
Type Mouse Untagged Clone
Tag Tag Free
Symbol Jak1
Synonyms C130039L05Rik; MGC37919
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC031297
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACCACCTCAAGAAGCAGATCCTGCGCACGGACAACATAAGCTTTGTGCTGAAACGATGCTGTCAGC
CTAAGCCTCGAGAAATCTCCAATCTGCTCGTAGCCACTAAGAAAGCCCAGGAGTGGCAGCCTGTCTACTC
CATGAGCCAGCTGAGCTTTGATCGGATCCTTAAGAAAGATATTATACAAGGTGAGCACCTTGGCAGAGGC
ACAAGAACACATATCTATTCTGGGACCCTGCTGGACTACAAGGATGAGGAAGGAATTGCTGAAGAGAAGA
AGATAAAAGTGATCCTCAAAGTCCTAGACCCCAGCCACCGGGACATCTCTCTGGCCTTCTTTGAGGCTGC
TAGCATGATGAGACAGGTTTCCCACAAACATATAGTGTACCTCTACGGCGTGTGTGTCCGAGATGTGGAA
AATATCATGGTGGAAGAGTTTGTGGAGGGGGGGCCGTTGGATCTCTTCATGCACCGGAAAAGTGATGCGC
TTACTACCCCCTGGAAGTTCAAGGTTGCCAAACAGCTGGCCAGTGCCCTGAGTTACTTGGAAGATAAAGA
CCTGGTTCATGGAAATGTGTGCACTAAAAACCTCCTTCTGGCCCGTGAGGGCATTGACAGTGACATTGGC
CCGTTCATCAAGCTTAGTGACCCTGGCATCCCAGTCTCTGTGCTGACCAGGCAAGAGTGCATAGAGCGAA
TCCCCTGGATCGCTCCTGAGTGTGTTGAAGACTCCAAGAACCTGAGTGTGGCTGCTGACAAGTGGAGCTT
TGGAACCACGCTCTGGGAAATCTGCTACAACGGAGAGATTCCTCTCAAAGACAAGACCCTCATTGAGAAA
GAGAGGTTTTATGAAAGCCGCTGCAGGCCTGTGACTCCATCTTGCAAGGAGCTAGCTGACCTCATGACTC
GCTGCATGAACTATGACCCCAACCAGAGACCCTTCTTCCGAGCCATCATGAGGGACATTAACAAGCTGGA
GGAGCAGAATCCAGACATTGTTTCAGAAAAGCAGCCAACAACAGAGGTGGACCCCACTCACTTTGAAAAG
CGGTTCCTGAAGAGGATTCGTGACTTGGGAGAGGGTCACTTTGGGAAGGTTGAGCTCTGCAGATATGATC
CTGAGGGAGACAACACAGGGGAGCAGGTAGCTGTCAAGTCCCTGAAGCCTGAGAGTGGAGGTAACCACAT
AGCTGATCTGAAGAAGGAGATAGAGATCTTACGGAACCTCTACCATGAGAACATTGTGAAGTACAAAGGA
ATCTGCATGGAAGACGGAGGCAATGGTATCAAGCTCATCATGGAGTTTCTGCCTTCGGGAAGCCTAAAGG
AGTATCTGCCAAAGAATAAGAACAAAATCAACCTCAAACAGCAGCTAAAATATGCCATCCAGATTTGTAA
GGGGATGGACTACTTGGGTTCTCGGCAATACGTTCACCGGGACTTAGCAGCAAGAAATGTCCTTGTTGAG
AGTGAGCATCAAGTGAAGATCGGAGACTTTGGTTTAACCAAAGCAATTGAAACCGATAAGGAGTACTACA
CAGTCAAGGACGACCGGGACAGCCCAGTGTTCTGGTACGCTCCGGAATGTTTAATCCAGTGTAAATTTTA
TATCGCCTCTGATGTCTGGTCTTTTGGAGTGACACTGCACGAGCTGCTCACTTACTGTGACTCAGATTTT
AGTCCCATGGCCTTGTTCCTGAAAATGATAGGCCCAACTCATGGCCAGATGACAGTGACACGGCTTGTGA
ATACTCTGAAAGAAGGAAAGCGTCTGCCATGTCCACCCAACTGTCCTGATGAGGTTTATCAGCTTATGAG
AAAATGCTGGGAATTCCAACCATCTAACCGGACAACTTTTCAGAACCTTATTGAAGGATTTGAAGCACTT
TTAAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN BC031297
ORF Size 2283 bp
Insert Size 2283
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC031297, AAH31297
RefSeq Size 2365
RefSeq ORF 1898
Locus ID 16451
Cytogenetics 4 46.19 cM

Other Versions

Other products for "Jak1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones