Actc1 (BC062138) Mouse Untagged Clone

CAT#: MC218133

Reviews ()
Write a review

Actc1 (untagged) - Mouse actin, alpha, cardiac (cDNA clone MGC:69991 IMAGE:6516862), (10ug)



  "BC062138" in other vectors (4)

USD 750.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Actc1 (BC062138) Mouse Untagged Clone
Type Mouse Untagged Clone
Tag Tag Free
Symbol Actc1
Synonyms Actc-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC062138
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGTGACGATGAGGAGACCACCGCTTTGGTGTGTGACAATGGCTCCGGGCTGGTGAAGGCCGGCTTTG
CGGGTGATGACGCCCCCAGAGCTGTCTTCCCATCCATCGTGGGTCGCCCACGCCACCAGGGTGTCATGGT
GGGTATGGGACAGAAGGACTCCTATGTAGGTGATGAAGCCCAGAGCAAGCGAGGTATCCTGACTCTGAAG
TACCCCATTGAACATGGCATTATCACCAACTGGGATGACATGGAGAAGATCTGGCACCATACATTCTACA
ATGAGCTCCGTGTGGCCCCAGAGGAACACCCAACCCTGCTCACTGAAGCCCCGCTGAACCCCAAGGCCAA
CCGTGAGAAGATGACCCAGATCATGTTTGAAACCTTCAATGTGCCTGCCATGTATGTCGCCATCCAGGCA
GTGCTGTCTCTGTATGCTTCTGGAAGAACCACAGGCATTGTTCTGGATTCTGGCGATGGTGTAACTCATA
ATGTTCCCATCTATGAGGGTTATGCCTTACCCCATGCCATCATGCGCCTGGATCTAGCTGGTCGGGACCT
CACTGACTACCTCATGAAGATCCTCACTGAGCGCGGGTACTCCTTTGTCACCACTGCTGAACGTGAAATT
GTCCGTGACATAAAAGAAAAACTGTGTTACGTCGCCCTGGATTTTGAGAACGAGATGGCCACAGCTGCAT
CTTCCTCCTCTCTGGAGAAGAGCTATGAACTTCCTGACGGCCAGGTCATCACCATTGGCAACGAGCGCTT
CCGCTGTCCAGAGACTCTCTTCCAGCCCTCTTTCATTGGTATGGAATCTGCTGGCATTCATGAAACTACT
TACAACAGCATCATGAAGTGTGACATCGATATCCGCAAAGACCTGTATGCCAACAATGTCCTATCTGGAG
GCACCACCATGTACCCTGGTATTGCCGATCGTATGCAAAAGGAAATCACTGCACTGGCTCCCAGCACCAT
GAAGATCAAGATTATTGCTCCCCCTGAGCGTAAATACTCTGTCTGGATTGGGGGCTCCATCCTGGCCTCT
CTGTCCACCTTCCAGCAAATGTGGATCAGCAAGCAAGAGTATGATGAGGCAGGCCCATCCATTGTCCACC
GCAAGTGCTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC062138
Insert Size 1134 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC062138, AAH62138
RefSeq Size 1454 bp
RefSeq ORF 1133 bp
Locus ID 11464
Cytogenetics 2 57.55 cM
Gene Summary Actins are highly conserved proteins that are involved in various types of cell motility and are ubiquitously expressed in all eukaryotic cells.[UniProtKB/Swiss-Prot Function]

Other Versions

Other products for "Actc1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools