Unc84b (BC098208) Mouse Untagged Clone

CAT#: MC217993

Unc84b (untagged) - Mouse unc-84 homolog B (C. elegans) (cDNA clone MGC:106463 IMAGE:6827666), (10ug)


  "BC098208" in other vectors (4)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Unc84b"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Unc84b
Synonyms SUN2, C030011B15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC098208
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGAGACGAAGCCAGCGCCTCACTCGCTACTCTCAGGATGATAACGATGGCGGCAGCAGCAGCAGTG
GTGCGAGCTCCGTGGCAGGAAGCCAGGGCACCGTGTTTAAAGACAGTCCTCTCAGGACTTTGAAGAGGAA
ATCCAGCAACATGAAGCACCTGTCCCCAGCTCCACAGCTGGGCCCCTCCTCTGACTCCCACACCTCCTAC
TACAGCGAGTCTGTGGTTCGAGAGTCCTACATCGGCAGCCCCCGGGCTGTGTCCCTCGCCAGGAGTGCCC
TCCTGGATGACCACCTACACAGTGAGCCCTACTGGAGCGGGGACCTTCGGGGGAGGAGGAGGAGAGGAAC
AGGTGGTTCTGAGAGCAGCAAGGCCAATGGGCTCACCGCGGAGAGCAAGGCCTCAGAAGACTTTTTCGGA
TCTTCCTCAGGCTATTCTTCAGAGGATGACCTTGCAGGCTACACGGACTCAGACCAGCACAGCTCGGGGT
CCAGGTTAAGGAGTGCAGCATCTCGGGCCGGCTCCTTTGTCTGGACTCTGGTCACTTTTCCAGGCCGCCT
CTTTGGTCTTCTCTACTGGTGGATTGGCACCACCTGGTACCGCCTGACAACTGCTGCCTCCCTCCTGGAT
GTCTTCGTCCTAACCAGGCACTTCTCGCTGAACCTGAAGAGTTTTCTGTGGTTCCTTCTGCTCTTGCTAC
TCCTGACTGGTCTGACCTACGGTGCTTGGCATTTTTACCCCTTAGGGCTGCAGACATTGCAACCCGCTGT
GGTCTCCTGGTGGGCAGCAAAAGAGAGCAGGAAGCAGCCAGAGGTGTGGGAATCCAGAGACGCCTCCCAG
CACTTCCAGGCTGAGCAGCGCGTTCTCTCCCGGGTTCACTCTCTGGAGCGGCGTCTGGAAGCCCTTGCTG
CAGACTTTTCCTCCAACTGGCAGAAGGAGGCCATACGGCTGGAACGCCTGGAGCTGCGGCAGGGGGCTGC
TGGCCATGGAGGAGGCAGTAGCCTGAGCCATGAAGATGCCCTGTCTCTCCTAGAAGGGTTGGTGAGCCGC
CGCGAGGCTACCCTGAAGGAGGACTTGCGCAGGGACACAGTGGCTCATATCCAGGAAGAATTGGCTACCC
TGAGGGCAGAGCATCACCAAGACTCGGAAGATCTCTTCAAGAAGATCGTCCAGGCCTCTCAGGAGTCCGA
AGCCCGAGTCCAGCAGCTGAAGACAGAATGGAAAAGCATGACCCAGGAGGCCTTCCAGGAGAGCTCTGTG
AAGGAGCTGGGACGGCTGGAAGCCCAGCTGGCCAGCCTGCGGCAGGAGCTGGCTGCCCTGACTCTGAAGC
AGAACTCGGTGGCAGATGAAGTGGGCCTGCTGCCACAGAAGATCCAGGCTGCCAGGGCTGATGTGAGCGG
GAAGTACCCAGAGCCCTACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC098208
Insert Size 1422 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC098208, AAH98208
RefSeq Size 4142 bp
RefSeq ORF 1421 bp
Locus ID 223697
Cytogenetics 15 E1
Gene Summary As a component of the LINC (LInker of Nucleoskeleton and Cytoskeleton) complex, involved in the connection between the nuclear lamina and the cytoskeleton. The nucleocytoplasmic interactions established by the LINC complex play an important role in the transmission of mechanical forces across the nuclear envelope and in nuclear movement and positioning. Specifically, SYNE2 and SUN2 assemble in arrays of transmembrane actin-associated nuclear (TAN) lines which are bound to F-actin cables and couple the nucleus to retrograde actin flow during actin-dependent nuclear movement. Required for interkinetic nuclear migration (INM) and essential for nucleokinesis and centrosome-nucleus coupling during radial neuronal migration in the cerebral cortex and during glial migration. Required for nuclear migration in retinal photoreceptor progenitors implicating association with cytoplasmic dynein-dynactin and kinesin motor complexes, and probably B-type lamins; SUN1 and SUN2 seem to act redundantly. The SUN1/2:KASH5 LINC complex couples telomeres to microtubules during meiosis; SUN1 and SUN2 seem to act at least partial redundantly. Anchors chromosome movement in the prophase of meiosis and is involved in selective gene expression of coding and non-coding RNAs needed for gametogenesis. Required for telomere attachment to nuclear envelope and gametogenesis. May also function on endocytic vesicles as a receptor for Rab5-GDP and participate in the activation of Rab5.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.