Rbm39 (BC030493) Mouse Untagged Clone

CAT#: MC217961

Rbm39 (untagged) - Mouse RNA binding motif protein 39 (cDNA clone MGC:40964 IMAGE:5400675), (10ug)

  View "BC030493" in other vectors (6)

USD 710.00


Availability*
2 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Rbm39 (BC030493) Mouse Untagged Clone
Symbol Rbm39
Synonyms caper
Vector pCMV6-Entry
Sequence Data
>BC030493
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAACTGGCAGCAAGAATTCGACCGAGAGATTTGGAAGAGTTTTTCTCTACAGTTGGAAAGGTTCGAG
ATGTGAGAATGATTTCTGATAGAAATTCAAGACGTTCCAAAGGAATTGCATATGTGGAATTTGTTGATGT
CAGTTCAGTGCCTCTAGCAATTGGATTAACTGGCCAACGAGTTTTAGGAGTGCCAATCATAGTTCAGGCA
TCACAGGCAGAAAAAAACAGAGCTGCTGCAATGGCAAACAATTTACAAAAGGGAAGTGCTGGACCTATGA
GGCTCTATGTAGGCTCATTACACTTTAACATAACTGAAGACATGCTTCGGGGGATCTTTGAACCTTTTGG
AAGGATTGAAAGTATTCAGCTCATGATGGATAGTGAAACTGGCCGATCTAAGGGATATGGATTTATTACA
TTTTCTGACTCAGAATGTGCCAAAAAGGCTTTGGAACAACTGAATGGATTTGAGTTAGCTGGGAGACCAA
TGAAAGTTGGTCACGTTACTGAACGAACTGATGCTTCGAGTGCTAGTTCATTTTTGGACAGTGACGAACT
AGAAAGGACTGGAATTGACTTGGGAACAACTGGACGTCTTCAGTTAATGGCAAGACTTGCGGAGGGTACC
GGTTTGCAGATTCCACCTGCCGCACAACAAGCATTACAAATGAGTGGCTCTCTGGCATTTGGTGCTGTGG
CAGATTTGCAAACACGACTTTCCCAACAGACCGAAGCCTCAGCTTTAGCTGCAGCTGCGTCTGTTCAACC
TCTTGCAACACAGTGTTTCCAACTTTCTAACATGTTTAATCCTCAAACAGAAGAAGAAGTTGGATGGGAT
ACAGAGATTAAAGATGATGTCATTGAAGAATGTAATAAACATGGAGGAGTCATTCATATTTATGTTGATA
AAAATTCAGCTCAGGGCAATGTGTATGTGAAGTGCCCATCTATTGCTGCGGCTATTGCTGCTGTCAATGC
ATTGCATGGCAGATGGTTTGCTGGTAAAATGATAACAGCAGCGTATGTACCTCTTCCAACTTACCACAAC
CTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN BC030493
ORF Size 1104 bp
Insert Size 1104
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC030493,
RefSeq Size 2413
RefSeq ORF 1104
Locus ID 170791
Cytogenetics 2|2 H1

Other Versions

Other products for "Rbm39"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies