Snx11 (NM_001163389) Mouse Untagged Clone

CAT#: MC217909

Snx11 (untagged) - Mouse sorting nexin 11 (Snx11), (10ug)

USD 691.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Snx11 (NM_001163389) Mouse Untagged Clone
Symbol Snx11
Synonyms 4933439F10Rik; A930041K09Rik; AI117694
Vector pCMV6-Entry
Sequence Data
>MC217909 representing NM_001163389
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCTTGTGGTATAGGATGTTGGAGAACCAAGACCTGGAGGAGGTGATCACAGTTCGAGTTCAGGACC
CCAGGGTGCAGAATGAAGGCTCCTGGAATTCTTACGTGGACTATAAGATATTCCTCCATACGAACAGCAA
GGCTTTTACCGCCAAGACGTCCTGTGTGCGGCGGCGCTACCGTGAGTTTGTGTGGCTGAGGAAGCAGCTG
CAGAGGAACGCCGGCTTGGTGCCTGTTCCGGAGCTTCCTGGGAAGTCCACTTTCTTTGGCGGCTCCGATG
AGTTCATTGAGAAGCGACGTCAAGGTCTCCAGCATTTCCTTGAAAAGGTCCTACAGAGCGTGGTTCTTCT
GTCAGACAGTCAGTTGCATCTCTTCCTCCAAAGCCAGCTCTCGGTGCCCGAGATTGAAGCCTGTGTCCAG
GGCCGGGGCGCCATGACGGTGTCCGATGCCATTCTTTCCTATGCTATGTCCAACTGTGGCTGGGCCCAGG
AGGAGAGGCAGAGCACCTCCCACTTGGCTAAAGGAGACCAGCTCAACAGTTGCTGCTTTCTTCCAAGATC
AGGGCGCAGGAGCTCCCCTTCGCCGCCTCTCAGTGAGGAGAAGGAGCAGTTAGAGACGTGGGCTCCAGTG
ATGGACTCTGAGGGCCCATCCTCAGAAAGCCCCACGCTGCTGCCCAGCTCCTCCTTGCCTGCCTGCTGGG
ATCCTGCAAGACCGGAGGAGGGACTCTCTGTGTCCCAGCCTGCGAGAAGGGCCGTGGCAGCGGACCAGGC
TGGGCCGATGGAGCCCACTCAGCTAGACACAGCGTGGGACAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001163389
ORF Size 816 bp
Insert Size 816
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001163389.1, NP_001156861
RefSeq Size 2521
RefSeq ORF 816
Locus ID 74479
Cytogenetics 11|11 D
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.