Ccdc127 (NM_001168659) Mouse Untagged Clone

CAT#: MC217837

Ccdc127 (untagged) - Mouse coiled-coil domain containing 127 (Ccdc127), transcript variant 1, (10ug)

USD 691.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ccdc127 (NM_001168659) Mouse Untagged Clone
Symbol Ccdc127
Synonyms 0610011N22Rik; 5430420E17Rik; A430066A18; AI256405; AW050060; C130002N06
Vector pCMV6-Entry
Sequence Data
>MC217837 representing NM_001168659
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATAACTTAAACGACCCCCCAAATTGGAATATCAGGCCCAATGCCAGGGCTGATGGGGGTGATGGAA
GCAAGTGGAATTATGCCCTATTGGTGCCAATGCTCGGATTGGCAGCATTTCGTTGGATTTGGTCTAGGGA
ATCCCAAAAAGAGATAGAAAAAGCCAGAAAAGCATATCATCAGAGAACAGCTGCTTTCCAACAGGATCTT
GAAGCCAAATACCATGCTGTGATCTCAGAACACCGGCGCGCTGTGGCTCAGCTGTCTTTGGAACTGGAAA
AAGAGCAAAATAGAACAAGTAGTTTTCGAGAAGCCCTCATCTCGCAGGGGCGTAAGTTGGCAGAAGAAAA
GAAACTTCTCGAACAGGAACGGGCTCAGATAAAGCAAGAAAAAAGCCGGCTCCAGCCTCTGAGAAATGTC
TATTTGAGCTGCCTGCAAGAAGAGGATGACTGGCAGAGGAGAGCCCAGCATGTGCTGAAAGAGGTGGGAG
AAGCTCTCGAGGAACGCCAAAATATCTATTGTAGCCTGATCATCCCCCGTAGTGCACGACTAGAGCTGGA
GAAGAGCTTACTGGTGCGCACATCTGTTGATCCAGTGGCTGCTGACCTAGAAATGGCAGCTGGCTTGTCT
GACATATTTAAGCATGATAAGCATTGTGGAGATGTCTGGAACACCAACAAACGTCAAAATGGGAAGCTCA
TGTGGATGTATCTCAAATACTGGGAACTACTTGTCGAACTTAAAAAATTTAAGAAAGTAGAGAAGGTCAT
ATTAGAAAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001168659
ORF Size 783 bp
Insert Size 783
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001168659.1, NP_001162130
RefSeq Size 3436
RefSeq ORF 783
Locus ID 67433
Cytogenetics 13|13 C1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.