Fip1l1 (BC003263) Mouse Untagged Clone

CAT#: MC217830

Fip1l1 (untagged) - Mouse FIP1 like 1 (S. cerevisiae) (cDNA clone MGC:7777 IMAGE:3499130), (10ug)

USD 691.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Fip1l1 (BC003263) Mouse Untagged Clone
Symbol Fip1l1
Synonyms Rje
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>BC003263
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGGCCGGCGAGGTGGAGCGCCTGGTGGAGCTGAGCGGCGGGACCGGAGGGGATGAGGAGGAAGAGT
GGCTGTATGGCGGCCCGTGGGACGTGCATGTGCACAGTGACTTGGCAAAGGATCTAGATGAGAATGAAGT
TGAAAGGCCAGAAGAAGAAAATGCCAGTGCTAATCCTCCATCTGGAATTGAAGAAGAAGCTGCTGAAAAT
GGCGTGGCAAAACCGAAAGTGACAGAGACTGAAGACGACAGTGATAGTGACAGTGACGATGATGAAGATG
ATGTTCACGTCACTATAGGAGACATCAAAACAGGAGCACCACAGTATGGGAGTTATGGAACAGCACCAGT
AAATCTTAATATCAAGGCAGGGGGAAGAGTTTATGGAAATACAGGAACCAAAGTCAAAGGAGTGGACCTC
GATGCACCTGGCAGCATTAATGGAGTTCCACTCTTGGAAGTAGATCTGGATTCTTTTGAAGATAAACCAT
GGCGGAAACCTGGTGCTGATCTTTCTGATTATTTTAACTATGGCTTTAATGAAGATACTTGGAAAGCTTA
CTGTGAAAAACAAAAGAGGATACGAATGGGACTGGAAGTTATACCTGTTACTTCAACCACAAACAAGATT
ACGGCCGAAGACTGTACTATGGAAGTTACACCAGGTGCAGAGATCCAAGATGGCAGATTCAATCTTTTTA
AGGTACAGCAAGGGAGAACTGGAAATTCAGAGAAAGAAGCAGCACTTCCATCTACAAAAGCTGAGTTTAC
TTCTCCGCCATCATTGTTCAAGACTGGTCTGCCACCAAGCAGAAACAGCACCTCTTCTCAGTCTCAGACA
AGTACTGCCTCCAGAAAAGCCAGTTCAAGCGTTGGGAAGTGGCAGGATCGATATGGGAGGGCCGAGTCAC
CTGATCTAAGGAGATTACCTGGAGCAATTGATGTCATTGGTCAAACAATAACCATCAGCCGAGTGGAAGG
AAGACGGCGTGCAAATGAGAACAGCAATATACAGGTCCTTTCTGACAGATCTGCCACTGAAGTAGACAAC
AATTTCAGCAAACCACCTCCATTTTTCCCTCCAGGGGCTCCTCCTACTCACCTTCCTCCTCCTCCATTTC
TCCCACCACCTCCAACTGTCAGCACCGCCCCACCTCTCATTCCACCACCAGGTTTCCCCCCTCCACCAGG
CGCCCCACCTCCATCTCTTATACCAACAATAGAAAGTGGCCATTCCTCCGGGTATGACAGCCGTTCTGCA
CGAGCGTTTCCCTATGGCAATGTCGCCTTTCCCCACCTTACCAGTTCTGCTCCCTCATGGCCGAGCCTTG
TGGACACCACCAAGCAGTGGGACTATTATGCAAGGAGAGAAAAAGACCGAGACCGAGACCGGGAGAGAGA
CCGAGACAGAGAGCGAGAGCGGGACCGGGACAGAGAAAGGGAGCGCACCCGGGAGCGGGAGCGAGAGCGC
GACCACAGCCCCACCCCAAGTGTTTTCAACAGGTTTGTTGGGTGTGCGGGGCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN BC003263
ORF Size 1527 bp
Insert Size 1527
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC003263,
RefSeq Size 2109
RefSeq ORF 1527
Locus ID 66899
Cytogenetics 5|5 C3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.