Npm1 (BC054755) Mouse Untagged Clone

CAT#: MC217725

Npm1 (untagged) - Mouse nucleophosmin 1 (cDNA clone MGC:64789 IMAGE:6411700), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Npm1
• Synonyms: B23, NO38
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC054755
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAGACTCGATGGATATGGACATGAGTCCTCTTAGGCCTCAGAACTACCTTTTCGGCTGTGAACTAA
  AGGCTGACAAAGACTATCACTTTAAAGTGGATAATGATGAAAATGAGCACCAGTTGTCATTAAGAACGGT
  CAGTTTAGGAGCAGGGGCAAAAGATGAGTTACACATCGTAGAGGCAGAAGCAATGAACTATGAAGGCAGT
  CCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAACCAACAGTTTCCCTAGGGGGCTTTGAAA
  TTACACCACCTGTGGTCTTACGGTTGAAGTGTGGTTCAGGGCCTGTGCACATTAGTGGACAGCATCTAGT
  AGCTGTAGAGGAAGATGCAGAGTCTGAAGATGAAGATGAGGAGGACGTAAAACTCTTAGGCATGTCTGGA
  AAGCGATCTGCTCCTGGAGGTGGTAACAAGGTTCCACAGAAAAAAGTAAAACTTGATGAAGATGATGAGG
  ACGATGATGAGGACGATGAGGATGATGAGGATGATGATGATGATGATTTTGATGAAGAGGAAACTGAAGA
  AAAGGTCCCAGTGAAGAAATCTGTACGAGATACCCCAGCCAAAAATGCACAAAAATCAAACCAAAATGGA
  AAAGACTTAAAACCATCAACACCGAGATCAAAGGGTCAAGAGTCCTTCAAAAAACAGGAAAAGACTCCTA
  AAACACCAAAAGGACCTAGTTCTGTAGAAGACATTAAGGCAAAAATGCAAGCAAGTATAGAAAAAGGCGG
  TTCTCTTCCCAAAGTGGAAGCCAAGTTCATTAATTATGTGAAGAATTGTTTCCGGATGACTGACCAGGAG
  GCTATTCAAGATCTCTGGCAGTGGAGGAAATCTCTTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: BC054755
• Insert Size: 879 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC054755, AAH54755
• RefSeq Size: 1281 bp
• RefSeq ORF: 878 bp
• Locus ID: 18148
• Cytogenetics: 11 A4
• Gene Summary: Involved in diverse cellular processes such as ribosome biogenesis, centrosome duplication, protein chaperoning, histone assembly, cell proliferation, and regulation of tumor suppressors p53/TP53 and ARF. Binds ribosome presumably to drive ribosome nuclear export. Associated with nucleolar ribonucleoprotein structures and bind single-stranded nucleic acids. Acts as a chaperonin for the core histones H3, H2B and H4. Stimulates APEX1 endonuclease activity on apurinic/apyrimidinic (AP) double-stranded DNA but inhibits APEX1 endonuclease activity on AP single-stranded RNA. May exert a control of APEX1 endonuclease activity within nucleoli devoted to repair AP on rDNA and the removal of oxidized rRNA molecules. In concert with BRCA2, regulates centrosome duplication. Regulates centriole duplication: phosphorylation by PLK2 is able to trigger centriole replication. Negatively regulates the activation of EIF2AK2/PKR and suppresses apoptosis through inhibition of EIF2AK2/PKR autophosphorylation. Antagonizes the inhibitory effect of ATF5 on cell proliferation and relieves ATF5-induced G2/M blockade. In complex with MYC enhances the transcription of MYC target genes.[UniProtKB/Swiss-Prot Function]