Lef1 (BC057543) Mouse Untagged Clone

CAT#: MC217716

Lef1 (untagged) - Mouse lymphoid enhancer binding factor 1 (cDNA clone MGC:66504 IMAGE:6401514), (10ug)


  "BC057543" in other vectors (6)

Reconstitution Protocol

USD 732.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Lef1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Lef1
Synonyms 3000002B05; AI451430; Lef-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC057543
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCCAACTTTCCGGAGGAGGCGGCGGGGGGGACCCGGAACTCTGCGCCACCGATGAGATGATCCCCT
TCAAGGACGAAGGCGATCCCCAGAAGGAGAAGATCTTCGCCGAGATCAGTCATCCCGAAGAGGAGGGCGA
CTTAGCCGACATCAAGTCATCTTTGGTTAACGAGTCCGAAATCATCCCAGCCAGCAACGGGCATGAGGTG
GTCAGACAAGCCCCGTCCTCTCAGGAGCCCTACCACGACAAGGCCAGAGAACACCCTGATGAAGGAAAGC
ATCCAGACGGAGGCCTGTACAACAAGGGACCCTCCTACTCCAGTTACTCTGGCTACATAATGATGCCCAA
TATGAACAGCGACCCGTACATGTCAAATGGGTCCCTTTCTCCACCCATCCCGAGGACATCAAATAAAGTG
CCCGTGGTGCAGCCCTCTCACGCGGTCCACCCGCTCACCCCCCTCATCACCTACAGCGACGAGCACTTTT
CTCCGGGATCCCACCCGTCACACATCCCGTCAGATGTCAACTCCAAGCAAGGCATGTCCAGACACCCTCC
AGCTCCTGAAATCCCCACCTTCTACCCCCTGTCTCCGGGCGGCGTTGGACAGATCACCCCACCCATTGGC
TGGTTTTCCCATCATATGATTCCTGGTCCCCCTGGCCCCCACACAACTGGCATCCCTCATCCAGCTATTG
TAACACCTCAGGTCAAACAGGAGCACCCCCACACGGACAGTGACCTAATGCACGTGAAGCCTCAACACGA
ACAGAGAAAGGAGCAGGAGCCCAAAAGACCTCATATTAAGAAGCCTCTGAATGCTTTCATGTTATATATG
AAAGAAATGAGAGCGAATGTCGTAGCTGAGTGCACGCTAAAGGAGAGTGCAGCTATCAACCAGATCCTGG
GCAGAAGATGGCACGCCCTCTCCCGGGAAGAGCAGGCCAAATACTATGAACTAGCACGGAAAGAGAGACA
GCTACACATGCAGCTTTATCCAGGCTGGTCAGCGCGAGACAATTATGGCAAGAAGAAGAAGAGGAAGAGA
GAGAAGCTACAGGAGTCGACTTCAGGTGGTAAGAGAAGCTCCTTCCCAACGTGCAAAGCCAAGGCAGCGA
CCCCAGGCCCTCTTCTGGAGATGGAAGCTTGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC057543
Insert Size 1155 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC057543, AAH57543
RefSeq Size 2999 bp
RefSeq ORF 1154 bp
Locus ID 16842
Cytogenetics 3 60.78 cM
Gene Summary Participates in the Wnt signaling pathway. Activates transcription of target genes in the presence of CTNNB1 and EP300. May play a role in hair cell differentiation and follicle morphogenesis. TLE1, TLE2, TLE3 and TLE4 repress transactivation mediated by LEF1 and CTNNB1 (By similarity). Regulates T-cell receptor alpha enhancer function. Binds DNA in a sequence-specific manner. PIASG antagonizes both Wnt-dependent and Wnt-independent activation by LEF1.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.