E4f1 (BC071228) Mouse Untagged Clone

CAT#: MC217697

E4f1 (untagged) - Mouse E4F transcription factor 1 (cDNA clone MGC:78185 IMAGE:4915902), (10ug)

USD 691.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name E4f1 (BC071228) Mouse Untagged Clone
Symbol E4f1
Vector pCMV6-Entry
Sequence Data
>BC071228
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGACGATGTGCACAGATGTGGCCGCTGCCAAGTGGAATTCACTGCCTTGGAGGACTTTGTCCAGCA
CAAGATTCAGAAGACCTGCCATCGGGCCCCGCAGGAGGCCCTGCCCACCACCCCTTGCCACTGCACTGCT
GGACCAGGAGGTGGTGCCCACAGCAGCAGAGGGAGGTCCAGATGAACCCATCACTGTGGCTCACATCGTG
GTGGAGGCCACCTCTCTAGCAGAAGACATCAGCCACGCTCCTGACCTTGTTGGAAGTGGGCACATCAAAG
AGGTCATTGTGGCTGCTGAGGCAGAGCCAGGGGATGGCGAGATGGCAGAGGCTCCAGGCAGTCCTAATCA
TCAGGAACTTGGGCTTCTTGGGGAGGGCGAGCAGGCCCATGTCAAGCTGCTGGTGAACAAGGAAGGCCGC
TACGTGTGCATGCTATGTCACAAGACCTTCAAAACGGGCAGCATCCTCAAGGCCCACATGGTAACGCACA
GCAGCCGCAAGGACCACGAGTGCAAGCTCTGTGGGGCCTCTTTTCGGACCAAGGGCTCTCTCATCCGGCA
CCACCGACGGCACACTGATGAGCGCCCCTACAAATGTGCCAAGTGTGGAAAGAGTTTCCGAGAGTCAGGC
GCACTGACTCGGCACCTCAAATCTCTCACTCCATGCACAGAAAAGATCCGCTTCAGCATAAGCAAGGACA
CAGCTGTGGGCAAAGAGGAAGTGCCTGCAGGGTCCAGTGCCTCCACTGTGGGGACGGTGACATCATCAGT
GGCAGGAGACCCCATGGAGACATCACCTGTGATTCACCTGGTGACAGATGCCAAGGGTACTGTCATCCAT
GAAGTCCACGTCCAGATGCAGGAGCTTCCCCTGGGCATGAAAGCCCTGACCCCAGAGTCCCCAGACTCGG
AGGAGCTCCCCTGTTCCAGTGAGAACAGCCGTGAGAACCTGCTACATCAGGCCATGCAGAATTCTGGCAT
CGTCCTTGAGAGGGTTGCTGGAGAGGAGAGTGCTCTGGAGCCAGCCCCTCCCTCTGGGTCCAGTCCCCAG
TGCCTGGGAGATGGATCCCCTGAACTGCCTCTGCTGAAGGTGGAGCAGATAGAGACACAGGTGGCCAGTG
AGGCCGCCACCGTGCCCAGGACCCACCCGTGCCCTCAGTGCAGTGAGACTTTCCCAACAGCAGCCACGCT
GGAGGCCCACAAGAGAGGTCACATAGTGTGGCAAGGCCTTCCCCAAAGCCTACCTGCTCAAGAAGCACCA
GGAGGTGCACGTGCACGAGCGCCGCTTCCGTTGTGGAGACTGTGGGAAGCTTTACAAGACCATCGCTCAT
GTGCGGGGCCACCGGCGTGTTCACTCAGACGAGAGGCCTTTCCCTTGTCCCCAGTGCGGCAAGCGTTACA
AAACCAAGAATGCCCAGCAAGTACACTTCCGGACACATCTGGAAGAAAAGCCCCACGTGTGCCAGTTCTG
CAGCCGAGGCTTCCGGGAGAAGGGCTCTCTGGTGCGGCATGTGAGGCACCACACAGGCGAGAAACCTTTC
AAGTGCTACAAGTGTGGCCGTGGCTTCGCGGAGCATGGCACACTCAACCGGCACCTGCGCACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN BC071228
ORF Size 1605 bp
Insert Size 1605
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC071228,
RefSeq Size 2551
RefSeq ORF 1605
Locus ID 13560
Cytogenetics 17 A3.3|17 12.39 cM
Gene Summary This gene encodes a member of the GLI-Kruppel zinc finger family. The encoded protein is likely to be multi-functional, with both adenovirus E1A-regulated transcription factor and ubiquitin E3 ligase activities, including roles in cell cycle regulation and the ubiquitination of p53. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.