Arid5a (NM_145996) Mouse Untagged Clone

CAT#: MC217640

Arid5a (untagged) - Mouse AT rich interactive domain 5A (MRF1-like) (Arid5a), transcript variant 3, (10ug)


  "NM_145996" in other vectors (4)

Reconstitution Protocol

USD 546.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Arid5a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Arid5a
Synonyms D430024K22Rik; Mrf1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC217640 representing NM_145996
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGCACCTCCGGCCAAAGGGAACACAGAGCAGTCAGAAGAAGGTGACCTCCCGCAGCTTCCTGTAT
CCCCCAAGCCAGATGATGAGCAGAGCAGGAGCCAGAGCCCCACCCAGCTCCAGGTGACAGGCCGCCGCCT
CTGGAAGAACGTGTATGATGAACTTGGCGGTAGCCCAGGCAGCACCAGTGCGGCCACATGCACACGCCGC
CACTATGAGAGGCTGGTCCTCCCATATGTGCGGCATCTGAAGGGGGAGGACGACAAGCCACTGCCTCCTA
CCAAGCCCAGGAAGCAATACAAGATGGCCAAGGAGCTGAGGGGAGACGATGGGACCACTGAGAAGCTGAA
GAAGGCCAAGGACTCAGAGGAGAGGCGGGTGGAGCAGACCACGCCAGGAAAGACCAAATCAGATGCCACT
GGCCAGACACAGCTTCCCTGCCAGGGATCCTCGAGGGACAGCACAGAACAGCTGGGCCCAGTATCTGGAC
CCTCTCCACCACTCACGGGTGCTAGTAGCTGCCCTGAGGCCTACAAGCGGCTCTTGTCAAGCTTTTACTG
CAAAGGGGCGCATGGCATCATGTCACCACTGGCCAAAAAGAAACTCCTGGCCCAGGTCAGCAAGGCAGAG
GCCTTGCAGTGCCAAGAAGAGGGCTGTCGCCATGGAGCAAGGAGCCCCAACAAGGACATTCAAGACAGTC
CCCAGAACCTAAGAGGGCCGGCTGAGAACTCTGAACACCAGCTAACCCCCCGGGAAGGATTGCAGGCCCC
TGGTGGGAGCACCAGGATGGAGGCCCAAGTGGGCCCCTGCCCTACAGCCCCCATGTTCTCAGGCTGTTTT
CATGCGTACCCCACCGAGGTGCTGAAACCTGTCAGCCAGCACCCTAGGGACTTCTTCTCCGGCCTTAAAG
ACAGGGTGCTGTTGGGACCACCTGGTAAAGAAGAAGGTCCGACAACCAAAGAGTCCCATCTGGTGTGGGG
TGGGGATGCCAACCACCCCTCTGCATTCCATAAAGGCAGCACAAGAAAAAGAAGTTTCTACCCCAAACCC
AAAGCCTGCTGGGTGTCTCCCATGGCCAAGGTCCCTACTGAGAGGCCTGGAGCCCCATCCCCTCATCCCA
GTAGCCCAGGTCTTGGCAGTAAGCGCGGCTTGGAAGAAGAGGGATTCGCTCATGGTGGCAAGAAACTGAG
GGCAGTGTCTCCCTTTCTGAAGGAGGTGGATTCCAAGGAGACTGGGGGCAAGCCTGCAGCCCCTGGCTTG
GCTGTATCCTGTCTACTGGGCCCAACCCCGGGGCCCACTCCTCCAGAGGCCTACAGGGGCACCATGCTGC
GGTGTCCTCTAAACTTCACCGGTAGCGCAGACCCTCTGAAGGGCCAGGCCTCACTCCCCTTCAGCCCCCT
GGTCATCCCTGCTTTCCCAGCCCACCTTCTGGCTACAACAGGCTCCTCACCTATGGCTGCCAGCCTGATG
CATTTCCCTCCCACGCCCTATGACGCTGTCCTACGCAACAGACTGGGTCCAGCTTCGTCTGCCTGGCACA
TGCCACCCGTCACAACCTATGCGGCACCTCACTTCTTCCACCTCAACACCAAACTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_145996
Insert Size 1599 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145996.4, NP_666108.2
RefSeq Size 5525 bp
RefSeq ORF 1599 bp
Locus ID 214855
UniProt ID Q3U108
Cytogenetics 1 B
Gene Summary DNA-binding protein that may regulate transcription and act as a repressor by binding to AT-rich stretches in the promoter region of target genes (By similarity). May positively regulate chondrocyte-specific transcription such as of COL2A1 in collaboration with SOX9 and positively regulate histone H3 acetylation at chondrocyte-specific genes. May stimulate early-stage chondrocyte differentiation and inhibit later stage differention (PubMed:21346191). Can repress ESR1-mediated transcriptional activation; proposed to act as corepressor for selective nuclear hormone receptors (By similarity). As RNA-binding protein involved in the regulation of inflammatory response by stabilizing selective inflammation-related mRNAs, such as IL6, STAT3 and TBX21. Binds to stem loop structures located in the 3' UTRs of IL6, STAT3 and TBX21 mRNAs; at least for STAT3 prevents binding of ZC3H12A to the mRNA stem loop structure thus inhibiting its degradation activity. Contributes to elevated IL6 levels possibly implicated in autoimmunity processes. IL6-dependent stabilization of STAT3 mRNA may promote differentiation of naive CD4+ T-cells into T-helper Th17 cells (PubMed:23676272, PubMed:27022145). In CD4+ T-cells may also inhibit RORC-induced Th17 cell differentiation independently of IL6 signaling (PubMed:24782182). Stabilization of TBX21 mRNA contributes to elevated interferon-gamma secretion in Th1 cells possibly implicated in the establishment of septic shock (PubMed:27671645).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks two alternate in-frame exons in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.