Rag2 (NM_009020) Mouse Untagged Clone

CAT#: MC217436

Rag2 (untagged) - Mouse recombination activating gene 2 (Rag2), (10ug)


  "NM_009020" in other vectors (4)

Reconstitution Protocol

USD 541.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rag2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rag2
Synonyms Rag-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC217436 representing NM_009020
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCCTGCAGATGGTAACAGTGGGTCATAACATAGCCTTAATTCAACCAGGCTTCTCACTTATGAATT
TTGATGGCCAAGTTTTCTTCTTTGGCCAGAAAGGCTGGCCTAAGAGATCCTGTCCTACTGGAGTCTTTCA
TTTTGATATAAAACAAAATCATCTCAAACTGAAGCCTGCAATCTTCTCTAAAGATTCCTGCTACCTCCCA
CCTCTTCGTTATCCAGCTACTTGCTCATACAAAGGCAGCATAGACTCTGACAAGCATCAATATATCATTC
ACGGAGGGAAAACACCAAACAATGAGCTTTCCGATAAGATTTATATCATGTCTGTCGCTTGCAAGAATAA
CAAAAAAGTTACTTTCCGTTGCACAGAGAAAGACTTAGTAGGAGATGTCCCTGAACCCAGATACGGCCAT
TCCATTGACGTGGTGTATAGTCGAGGGAAAAGCATGGGTGTTCTCTTTGGAGGACGTTCATACATGCCTT
CTACCCAGAGAACCACAGAAAAATGGAATAGTGTAGCTGACTGCCTACCCCATGTTTTCTTGATAGATTT
TGAATTTGGGTGTGCTACATCATATATTCTCCCAGAACTTCAGGATGGGCTGTCTTTTCATGTTTCTATT
GCCAGAAACGATACCGTTTATATTTTGGGAGGACACTCACTTGCCAGTAATATACGCCCTGCTAACTTGT
ATAGAATAAGAGTGGACCTTCCCCTGGGTACCCCAGCAGTGAATTGCACAGTCTTGCCAGGAGGAATCTC
TGTCTCCAGTGCAATCCTCACTCAAACAAACAATGATGAATTTGTTATTGTGGGTGGTTATCAGCTGGAA
AATCAGAAAAGGATGGTCTGCAGCCTTGTCTCTCTAGGGGACAACACGATTGAAATCAGTGAGATGGAGA
CTCCTGACTGGACCTCAGATATTAAGCATAGCAAAATATGGTTTGGAAGCAACATGGGAAACGGGACTAT
TTTCCTTGGCATACCAGGAGACAATAAGCAGGCTATGTCAGAAGCATTCTATTTCTATACTTTGAGATGC
TCTGAAGAGGATTTGAGTGAAGATCAGAAAATTGTCTCCAACAGTCAGACATCAACAGAAGATCCTGGGG
ACTCCACTCCCTTTGAAGACTCAGAGGAATTTTGTTTCAGTGCTGAAGCAACCAGTTTTGATGGTGACGA
TGAATTTGACACCTACAATGAAGATGATGAAGATGACGAGTCTGTAACCGGCTACTGGATAACATGTTGC
CCTACTTGTGATGTTGACATCAATACCTGGGTTCCGTTCTATTCAACGGAGCTCAATAAACCCGCCATGA
TCTATTGTTCTCATGGGGATGGGCACTGGGTACATGCCCAGTGCATGGATTTGGAAGAACGCACACTCAT
CCACTTGTCAGAAGGAAGCAACAAGTATTATTGCAATGAACATGTACAGATAGCAAGAGCATTGCAAACT
CCCAAAAGAAACCCCCCCTTACAAAAACCTCCAATGAAATCCCTCCACAAAAAAGGCTCTGGGAAAGTCT
TGACTCCTGCCAAGAAATCCTTCCTTAGAAGACTGTTTGATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009020
Insert Size 1584 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_009020.3, NP_033046.1
RefSeq Size 3393 bp
RefSeq ORF 1584 bp
Locus ID 19374
UniProt ID P21784
Cytogenetics 2 53.87 cM
Gene Summary Core component of the RAG complex, a multiprotein complex that mediates the DNA cleavage phase during V(D)J recombination. V(D)J recombination assembles a diverse repertoire of immunoglobulin and T-cell receptor genes in developing B and T-lymphocytes through rearrangement of different V (variable), in some cases D (diversity), and J (joining) gene segments. DNA cleavage by the RAG complex occurs in 2 steps: a first nick is introduced in the top strand immediately upstream of the heptamer, generating a 3'-hydroxyl group that can attack the phosphodiester bond on the opposite strand in a direct transesterification reaction, thereby creating 4 DNA ends: 2 hairpin coding ends and 2 blunt, 5'-phosphorylated ends. The chromatin structure plays an essential role in the V(D)J recombination reactions and the presence of histone H3 trimethylated at 'Lys-4' (H3K4me3) stimulates both the nicking and haipinning steps. The RAG complex also plays a role in pre-B cell allelic exclusion, a process leading to expression of a single immunoglobulin heavy chain allele to enforce clonality and monospecific recognition by the B-cell antigen receptor (BCR) expressed on individual B-lymphocytes. The introduction of DNA breaks by the RAG complex on one immunoglobulin allele induces ATM-dependent repositioning of the other allele to pericentromeric heterochromatin, preventing accessibility to the RAG complex and recombination of the second allele. In the RAG complex, RAG2 is not the catalytic component but is required for all known catalytic activities mediated by RAG1. It probably acts as a sensor of chromatin state that recruits the RAG complex to H3K4me3.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.