Celf2 (NM_001110228) Mouse Untagged Clone

CAT#: MC217418

Celf2 (untagged) - Mouse CUGBP, Elav-like family member 2 (Celf2), transcript variant 1, (10ug)

USD 670.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Celf2 (NM_001110228) Mouse Untagged Clone
Symbol Celf2
Synonyms B230218O03; B230345P09Rik; C88023; CELF-2; CUG-BP2; Cugbp2; D230046B21Rik; Etr-3; mETR-3; Napor;
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC217418 representing NM_001110228
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTGAGCGCACTTCTGAACTGGCTTTTGTTGAGACTATCAGTGTAGAAAGCATGCGCTGTCCCAAAT
CCGCTGTTACTATGAGAAATGAGGAGCTGCTTTTAAGTAACGGCACAGCCAACAAGATGAACGGAGCTTT
GGATCATTCAGACCAGCCAGACCCAGATGCCATTAAGATGTTTGTCGGACAGATCCCTAGGTCCTGGTCG
GAAAAGGAGCTGAAAGAACTTTTTGAGCCTTATGGAGCTGTCTACCAGATCAACGTCCTCCGGGACCGGA
GTCAGAACCCTCCCCAGAGTAAAGGTTGTTGTTTCGTAACATTTTATACAAGAAAAGCTGCACTTGAGGC
CCAGAATGCACTGCACAATATTAAAACTTTACCTGGGATGCATCATCCCATTCAGATGAAACCTGCAGAT
AGTGAAAAGTCAAACGCTGTGGAAGACAGAAAATTGTTCATAGGAATGGTTTCCAAGAAATGTAACGAGA
ATGATATCAGAGTGATGTTTTCTCCATTCGGTCAGATAGAAGAATGCCGGATTCTCCGGGGACCTGATGG
GCTGAGTCGAGGCTGTGCGTTTGTCACATTTTCTACAAGGGCAATGGCACAGAATGCAATCAAAGCCATG
CATCAGTCTCAGACCATGGAGGGCTGCTCTTCACCAATCGTGGTGAAGTTTGCTGACACTCAGAAGGACA
AAGAGCAAAGGCGCCTCCAGCAGCAGCTTGCACAGCAGATGCAACAGCTCAACACTGCCACTTGGGGGAA
CCTAACAGGACTGGGTGGACTTACCCCGCAGTACCTGGCGCTTCTGCAGCAGGCCACCTCCTCCAGCAAC
CTGGGTGCATTCAGTGGCATTCAGCAAATGGCTGGCATGAATGCTTTACAGTTACAGAATCTGGCAACAC
TGGCTGCTGCTGCAGCTGCTGCTCAAACCTCAGCCACCAGCACCAATGCAAACCCTCTGTCTAGCACAAG
CAGTGCCCTGGGAGCCCTCACAAGCCCTGTGGCTGCTTCAACCCCCAATTCCACCGCTGGTGCGGCCATG
AATTCCTTGACCTCTCTTGGGACTCTACAAGGATTGGCTGGAGCCACTGTCGGATTGAATAATATTAATG
CACTAGCAGGTATGGCGGCTCTGAATGGAGGACTTGGCGCCACAGGCTTGACGAATGGTACGGCTGGCAC
CATGGACGCCCTGACCCAGGCCTACTCAGGAATTCAGCAGTATGCGGCAGCTGCACTGCCCACTTTGTAC
AGCCAGAGCTTGCTGCAACAGCAGAGTGCTGCAGGCAGCCAGAAGGAAGGTCCAGAGGGGGCAAACCTCT
TTATTTACCACCTTCCACAGGAGTTTGGAGACCAGGACATTCTGCAGATGTTCATGCCCTTTGGAAATGT
TATCTCTGCTAAAGTCTTCATTGACAAACAGACCAATCTGAGCAAGTGCTTTGGTTTTGTTAGCTATGAC
AATCCAGTCTCTGCACAAGCTGCAATCCAGGCTATGAACGGCTTTCAGATCGGCATGAAACGCTTGAAGG
TGCAGCTGAAACGCTCCAAAAACGACAGCAAACCTTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001110228
ORF Size 1581 bp
Insert Size 1581
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001110228.1, NP_001103698
RefSeq Size 7662
RefSeq ORF 1581
Locus ID 14007
Cytogenetics 2|2 A1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.