Rbpjl (NM_009036) Mouse Untagged Clone

CAT#: MC217287

Rbpjl (untagged) - Mouse recombination signal binding protein for immunoglobulin kappa J region-like (Rbpjl), (10ug)

USD 660.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rbpjl (NM_009036) Mouse Untagged Clone
Symbol Rbpjl
Synonyms RBP-L; Rbpsuhl
Vector pCMV6-Entry
Sequence Data
>MC217287 representing NM_009036
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCCCAGGGAGACAACAGACCCCTCGTTGCCCCCGGGCCCTTTGACTCACCTGAGCCTGCCGGACA
GCTCAGAGGTGCGGCTACAGAGCGACGGGCCCAGCCTCCTGGGGAGTTGGACCAGGTCACCCCCAGAGCA
TGCCATCATCCTAAGAGAAGGTGTGCGCACATGCCTGCAGCAAAGATGTGAGCAGACTGTGTGGATCCTG
CATGCCAAGGTGGCTCAGAAATCCTATGGAAATGAGAAGCGGTTCTTCTGTCCTCCACCCTGTGTCTACC
TCGCGGGTCCTGGCTGGAGGGTGAAGCCAATGCAAGACCAAGCCCTCCAATCTGCGGAGACCGGGCCCAC
CGTCTGCGGTTACATGGGACTGGACGGTGCGTCCGGCAGCGCTCCCGAGACCCAGAAGTTGAACTTTGAA
GAGCAGCCGGACTCCAGGGAATTTGGTTGTGCCAAGACCCTGTACATCTCGGACGCCGATAAGAGGAAGC
ACTTCCGGCTGGTGCTGCGACTGGTGCTGCGAGGGGGCCAGGAGCTGGGCACTTTCCACAGTCGCCTCAT
CAAGGTGATCTCCAAGCCCTCGCAGAAGAAGCAGTCGCTGAAAAACACAGACCTATGCATCTCCTCCGGC
TCAAAGGTCTCCCTTTTCAATCGCCTGCGCTCCCAGACAGTGTCCACGCGTTACCTCTCTGTGGAAGATG
GGGCCTTTGTGGCCAGCGCAAGGCAGTGGGCTGCCTTCACCCTCCACCTGGCTGATGGGCACTGTTCCCA
AGGGGACTTCCCACCCCAGGAAGGTTACATCCGCTACGGCTCCCTGGTGCAGCTTGTCTGCACTGTCACA
GGCATTACACTGCCGCCTATGATCATCCGAAAAGTGGCCAAGCAGTGTGCCCTCCTTGATGTGGATGAAC
CCATATCCCAGCTGCACAAGTGTGCCTTCCAGTTTCCAAGTGACACCCCAGGAGGGGCTGGCACCTACTT
ATGCCTTGCCACAGAGAAGGTGGTGCGATTCCAGGCTTCCCTCTGCCCCAAGGAGGCCAACAGGGCGCTG
CTCAACGACAGCTCTTGCTGGACCATCATTGGCACGGAGTCGGTGGAGTTCACCTTCAGCACCAGCCTGG
CCTGTACTCGGGAGCCCGTCACTCCGGTGCCTCTCATCAGCACTCTGGAGCTGAGCGGTGGAGGTGATGT
GGCCACGCTGGAGCTGCACGGAGAAAATTTCCACGCTGGGCTCAAGGTGTGGTTCGGAGACGTGGAGGCA
GAAACCATGTACAGGAGCCCTCGTTCCTTGGTGTGCGTAGTGCCAGACGTGGCGGCCTTCGGCAGCGACT
GGCGTTGGCTCCGCACCCCCATCACCGTGCCCGTGAGCTTGCTGCGCGCGGATGCGCTCTTCTACCCCAG
CCCCTTCTCTTTCACCTACACCCCGGAATACAGCGCGCTGCCACGGCTGCCCAACGCGCAAGAGCCTGCC
CCCGACGCGGACACGCTCCTGGAGAGCATCCACCACGAGTTCACACGCACCAACTTCCATCTCTTCTGCC
CCACCTAG


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN NM_009036
ORF Size 1548 bp
Insert Size 1548
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_009036.1, NP_033062
RefSeq Size 2456
RefSeq ORF 1548
Locus ID 19668
Cytogenetics 2 H3|2 85.16 cM
Gene Summary Putative transcription factor, which cooperates with EBNA2 to activate transcription. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.