Tagap1 (NM_147155) Mouse Untagged Clone

CAT#: MC217227

Tagap1 (untagged) - Mouse T-cell activation GTPase activating protein 1 (Tagap1), (10ug)

USD 649.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tagap1 (NM_147155) Mouse Untagged Clone
Symbol Tagap1
Synonyms 2610315E15Rik; AA415005; FKSG15
Vector pCMV6-Entry
Sequence Data
>MC217227 representing NM_147155
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGACTACCGCCGCGGTGGTGGCCGAGGAAGACACGGAGCTGCGCGACCTGCTGGTGCAGACGC
TGGAGAACAGCGGCGTGCTGAACCGCATCAAGGCTGAACTCAGAGCGGCTGTGTTTTTAGCACTAGAAGA
ACAAGAAAAAGTAGAGGTTAAGATCTTGGTGGAATTCCTCATCGACAACTGCTTTGAGATATTTGGGGAG
AACATTCGGACGCGTTCCCGCATCACTTCTGACGACTCCCTGGAACACACTGACAGTTCAGACGTGTCAA
CTCTGCAGAATGACTCGGCCTATGACAGCAATGACCCAGATGTGGAGCCCACAAGTGGCGCAGCCTCTCC
CAACAGGCAACTGGAGGGTCCCACTCCCACAATGGCTGGTCTGGATACCCGGGGCCACCGGGACACCTGT
GAGTCAAGCTCAGAGTCCAGCGTTAGCATGGTAGTCAGGCTGAAAAACTCCATTGTCCAACAAGACAGGC
GGTTCTCTGAACCCAACATGTCACCCTCACGAGAGTGCCTCGTGGGCCCAACATCCAAGCAAAAGCTAAC
AAGGAGTGAGGACAGCTTCACTCTGTCCCAGGACGCCTCCTGTTCTGAAGGCGATGAAGCTGAAGATCCC
TTTACAGAGGAAGTCTTCCCAGCAGTGGACAGCAAACCCAAGAGACCTGTGGATTTGAAAATAAAGAATT
GGACCCAAGGTTTAGCATCTCCACAGGGACACATAACCAAAGCTTTCTCCAGATCCTCCCCAGGCGAATC
TTTGGGCAGCTCACCTGTGCCTTCTCCATCCTGCCCCAAGAGAAACTTCTTCACCAGACACCAGAGTTTC
ACAACAAAGACAGACAAAACCAAACCCCAGAGAGAAATTAGAAAGCACTCCATGTTGTTTTCCTTTGCGT
CTCACAAGAAAGTGCTGCCCCGAACCTCCAGCATTGGGTCTGAGAAATCCAAAGACTTTTCTAGAGACCA
ACTCCAGAAGGACTTGAGGAAAGAGAGCCAACTTTCTGGCAGAATCGTCCAGGAAAATGAGTCAGAAATC
CAAAGCCAAACATCTTTGGGCTTCAGCTTGTCTGGCACCTGGGCCCTCTCAGTCGACAACACGTTCCAGT
TAGTGGATATGAGGAAACCAGGAAGCCCACCATCTTACGAAGAGGCCATTTATTACCAGACATCAGGACT
CACAGCCTACGGTGGCCAGACAGTTGGGAGTATGAGGTCAAGAATGTTCAAGCCAAGCACAGCGGTGCCC
CCTGTGCCTTCTCACCATGGAGGTGACCTCAGTGAAGGGACACCTGGTGGACACAGATTGTCTTCTGTGA
CTGAGCACTGGACACACAGTCAGACTGTCCATGTCTCTATAGAAACTCAGGGGAGATCTGAGCTACACCA
GTTGAGGACAGTGTCCGAGTCCATGCAGAAGGCTAAGCTGGACTGTCTTGGGCCACAACACAGCCACTTA
GTCTTTGAGGCTGACCAACTCTGCTGTGCTAGAGAATCCTACATTTAA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN NM_147155
ORF Size 1518 bp
Insert Size 1518
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_147155.2, NP_671511
RefSeq Size 2358
RefSeq ORF 1518
Locus ID 380608
Cytogenetics 17|17 A1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.