Gfy (NM_001195255) Mouse Untagged Clone

CAT#: MC217194

Gm581 (untagged) - Mouse predicted gene 581 (Gm581), (10ug)

USD 649.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gfy (NM_001195255) Mouse Untagged Clone
Symbol Gfy
Synonyms Gm2515; Gm581; Goofy
Vector pCMV6-Entry
Sequence Data
>MC217194 representing NM_001195255
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCCCTTCAGCCCCATCTTCTTCCACCTCCTCTTTCTCCTTAATGGTCTGAGTTCCAGGGCAGCTC
CCTCACCAGGGCAGCCTGTGGTCGCTGACCTCCAGGGGATGCTCCAGCCCTCTGGGATGCCCACTGGTAC
TCTAGAAAATCTTACTAGAGATCAACCTACCCCAGGATCCTCTGCAAGCCATCCTCCTGAGCACTCCGAG
ACACCACCCTCAGCTTCCCCTCACATCTCCACAAAAATCTTAAGGGAGACCCCTAGCCCCAGCCCCTTTC
TTTCTCTAGAGACTCCCATACCTGACCAGCTCACATCAGTAGCAGAATCTCAGGGTACTTCACAAATGAG
TCCCTCCAGAGCAACACTTGGTAAACCTTCTGAGACCCCCAAACCTGACCCAACTGGAATTTCCCCGTCT
GACTCTCCAGAAACCCCAAAACCTAACCCCTCCAACACCTCACCCCCAGAGTCTCCTGAGTCTGTATACA
CTGACCCCACACCAACTCTACACCATGAATCCCCTGAAATCTCCAAAAGAGATACCCCCAAACTCTCACC
TGGTGAAGAGTCTAAGATACCAAGTCCCAGACCCACCCAATTCCTCAGCTCCAAATCCCTAGAGACCTAC
GACCCCAGTGCCACGAGACACCTAAATTCTGCACTGGAACCAACCACCCACCCTGACCCTACAGAAAGTC
CACAGTCAGTCTTTCTCACCACTCACAACTCTAATCCCACTGTTGTCCCCCAAACCCAATTCCCCACATC
CCCCAGCCAAAATGTAACAGAAACGGCTAGGACCTCTGACTTGGAACCCAGCTCTAGTCTTCCCACCCAG
CCAACAACCTTCAGGGAGGAAGCCACCACTCCCAGTGAGCCAGGCTTGAGTCCCAGCCCAGAAGCCCCTG
CAGTCACCCGAGTTGCCACCCCTGGCCTGTCCACCTCAGATTCCCCAGGGACCAAAGAGCTGCACGTACC
CCAGAACTCAGACCCTAAAGGGCCAGATATCCCTCTTCCCTCAGCAAGGATTGCAGGGCCCCCCGCTCCT
CTGGAGCACCCCAATCAGGTAGCACCTGCCCCTCAGAGACACAGCCGAGGAGACACAGTCAACACTATCA
TCGTGGTGGAGCGAGTGAAGGAGACGGGGGTGACTCTGGTCAGCCGCCCACGAGGCTCCGTCGGTGGGGC
TCTGTGCCTGTTCTTCGCGGGGACAGGGCTGCTGATTGGCATCTTCCTGCTGCTGTGGTGCCTCTACCGC
CGAGCCTCCAGACACAGGTCCTTTGCCCACCACCGGCTCCGGGACAGCGGAGATGAACCAGTCTTGCACC
TCGATGCCCCGAAGGACCCGCTGGATCTCTACTTCTACGCCCCCGATGCGTGGGTGCCCTCCCACATCGC
CACGCAGCCTCCACCTTCCACGCCCCCGCTGCCGCCCAAGCTGCCCCCTCCGCCTCGCGGGCCGCAGCGC
CTGGAAGCCCTGTCGCCCGCCGCACTGTCCCCCAACTTCTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001195255
ORF Size 1515 bp
Insert Size 1515
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001195255.1, NP_001182184
RefSeq Size 1877
RefSeq ORF 1515
Locus ID 100039953
Cytogenetics 7 B3|7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.