Prss16 (NM_019429) Mouse Untagged Clone

CAT#: MC217162

Prss16 (untagged) - Mouse protease, serine, 16 (thymus) (Prss16), (10ug)

USD 649.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Prss16 (NM_019429) Mouse Untagged Clone
Symbol Prss16
Synonyms AI448615; TSSP
Vector pCMV6-Entry
Sequence Data
>MC217162 representing NM_019429
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGTCAAGGCTCCATGGTTGGGATTCTTGCTTCTGGTTTCCCTCTGGGGACTGTCAACTCCAGCCT
TGCTTCTCAGGCGCCTGAGGGAACACATTCAGAAGTTTCAGGAGAGCTCTAGCCTACACCCAGGCTTTGG
ACTAGGCCATGGTCCTGGGGCTGTCCCCAAACAAGGGTGGTTAGAACAGCCACTGGATCCCTTCAATGCA
TCTGACAGACGAACCTTCCTGCAGCGGTACTGGGTGAATGATCAACACAGAACTGGCCAAGATGTACCAG
TATTTCTGCACATAGGAGGCGAGGGCAGCCTTGGGCCTGGCTCAGTGATGGCAGGGCATCCTGCGGCACT
GGCCCCTGCCTGGGGGGCCCTGGTGATAAGCCTAGAACACAGATTCTATGGTTTGAGTATGCCTGCTGGG
GGCCTGGATCTGGCCCTGCTTCGCTACTTGTCCAGCCGCCATGCGTTGGCTGACGTGGCTTCCGCTCGCC
AGGCGCTCTCCGGCCTCCTCAATGTGTCTTCTTCCAGCCCTTGGATCTGCTTCGGAGGCTCCTACGCTGG
CTCGCTGGCGACCTGGGCCCGGCTGAAGTTCCCCCACCTAGTCTTTGCCGCCGTCGCCTCCTCAGCACCG
CTGAGCGCTGTAGTGGACTTCTCCGCCTATAACCAGGTGGTGGCCAGAAGCCTGACACAAGTCGCCATAG
GAGGATCATTGGAGTGTCTGGCGGCGGCCTCCACCGCCTTCACGGAGGTGGAGCGGCTGCTGCGCGCAGG
CCCGGCGGCTCAGGCTGTGCTGAGGGAGGAACTGGGCGCCTGCGGGTCCCTGGACCTTACGGAAGACCAG
GCGGAGCTGCTGGGAGCGTTGCAGGCGCTGGTGGGCGGCACCGTGCAGTACGACGGGCAGGCGGGAGCGC
CGCTAAGCGTGCGCCAGCTCTGCGGTCTCCTGCTCGGGAAGTGGGGAAACCGCAGCCGCTCCACGCCCTA
CTTGGGGCTTCGCCGGGCTGTACAGATAGTCTTGCGCAGCATGGGACAGAAGTGTTTAAGCTTTTCCCGG
GCAGAGACAGTGGCACAGCTGAGCAACACCGAACCGCAAGTGTCTGGTGTGGGGGACCGGCAGTGGTTGT
ACCAGACATGCACTGAGTTTGGCTTCTATGTCACCTGTGAGGGTCTTCAGTGTCCTTTTTCCCAGCTCCC
AGCACTGCCCTTCCAGCTAGAGCTGTGTGAACAAGTGTTTGGCCTCTCACCTGCATCTGTTGCCCAGGCT
GTGGCCCAGACAAACTCCTATTATGGTGGTCAGAGCCCTGGAGCCACCCAAGTACTGTTTGTTAATGGAG
ACACAGATCCTTGGCATGTATTGAGCGTAACACAGGACTTAGGACTGTCTGAGCCAGCCCTTCTAATTCC
TAGTGCTTCCCACTGCTTCGATATGGCACCTATGAGGCCTTCAGACTCTCCCAGCCTCCGCCTGGGACGT
CAGAAAATCTCCCAGCAATTACAGGATTGGCTCAAAGATATAAAGAAGAGCCAGAGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_019429
ORF Size 1530 bp
Insert Size 1530
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_019429.2, NP_062302
RefSeq Size 2152
RefSeq ORF 1530
Locus ID 54373
Cytogenetics 13 A3.1|13 8.12 cM
Gene Summary Protease that may play a role in T-cell development. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.