Acvr1b (NM_007395) Mouse Untagged Clone

CAT#: MC217130

Acvr1b (untagged) - Mouse activin A receptor, type 1B (Acvr1b), (10ug)


  "NM_007395" in other vectors (4)

Reconstitution Protocol

USD 518.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Acvr1b"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Acvr1b
Synonyms 6820432J04; ActR-IB; ActRIB; Acvrlk4; Alk4; SKR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC217130 representing NM_007395
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGTCGGCCGGAGCCTCCTCCTTCTTCCCCCTTGTTGTCCTCCTGCTCGCCGGCAGCGGCGGGT
CCGGGCCCCGGGGGATCCAGGCTCTGCTGTGTGCGTGCACCAGCTGCCTACAGACCAACTACACCTGTGA
GACAGATGGGGCTTGCATGGTCTCCATCTTTAACCTGGATGGCGTGGAGCACCATGTACGTACCTGCATC
CCCAAGGTGGAGCTGGTTCCTGCTGGAAAGCCCTTCTACTGCCTGAGTTCAGAGGATCTGCGCAACACAC
ACTGCTGCTATATTGACTTCTGCAACAAGATTGACCTCAGGGTCCCCAGCGGACACCTCAAGGAGCCTGC
GCACCCCTCCATGTGGGGCCCTGTGGAGCTGGTCGGCATCATCGCCGGCCCCGTCTTCCTCCTCTTCCTT
ATCATTATCATCGTCTTCCTGGTCATCAACTATCACCAGCGTGTCTACCATAACCGCCAGAGGTTGGACA
TGGAGGACCCCTCTTGCGAGATGTGTCTCTCCAAAGACAAGACGCTCCAGGATCTCGTCTACGACCTCTC
CACGTCAGGGTCTGGCTCAGGGTTACCCCTTTTTGTCCAGCGCACAGTGGCCCGAACCATTGTTTTACAA
GAGATTATCGGCAAGGGCCGGTTCGGGGAAGTATGGCGTGGTCGCTGGAGGGGTGGTGACGTGGCTGTGA
AAATCTTCTCTTCTCGTGAAGAACGGTCTTGGTTCCGTGAAGCAGAGATCTACCAGACCGTCATGCTGCG
CCATGAAAACATCCTTGGCTTTATTGCTGCTGACAATAAAGATAATGGCACCTGGACCCAGCTGTGGCTT
GTCTCTGACTATCACGAGCATGGCTCACTGTTTGATTATCTGAACCGCTACACAGTGACCATTGAGGGAA
TGATTAAGCTAGCCTTGTCTGCAGCCAGTGGTTTGGCACACCTGCATATGGAGATTGTGGGCACTCAAGG
GAAGCCGGGAATTGCTCATCGAGACTTGAAGTCAAAGAACATCCTGGTGAAAAAAAATGGCATGTGTGCC
ATTGCAGACCTGGGCCTGGCTGTCCGTCATGATGCGGTCACTGACACCATAGACATTGCTCCAAATCAGA
GGGTGGGGACCAAACGATACATGGCTCCTGAAGTCCTTGACGAGACAATCAACATGAAGCACTTTGACTC
CTTCAAATGTGCCGACATCTATGCCCTCGGGCTTGTCTACTGGGAGATTGCACGAAGATGCAATTCTGGA
GGAGTCCATGAAGACTATCAACTGCCGTATTACGACTTAGTGCCCTCCGACCCTTCCATTGAGGAGATGC
GAAAGGTTGTATGTGACCAGAAGCTACGGCCCAATGTCCCCAACTGGTGGCAGAGTTATGAGGCCTTGCG
AGTGATGGGAAAGATGATGCGGGAGTGCTGGTACGCCAATGGTGCTGCCCGTCTGACAGCTCTGCGCATC
AAGAAGACTCTGTCCCAGCTAAGCGTGCAGGAAGATGTGAAGATTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007395
Insert Size 1518 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007395.3, NP_031421.1
RefSeq Size 3277 bp
RefSeq ORF 1518 bp
Locus ID 11479
UniProt ID Q61271
Cytogenetics 15 56.48 cM
Gene Summary Transmembrane serine/threonine kinase activin type-1 receptor forming an activin receptor complex with activin receptor type-2 (ACVR2A or ACVR2B). Transduces the activin signal from the cell surface to the cytoplasm and is thus regulating a many physiological and pathological processes including neuronal differentiation and neuronal survival, hair follicle development and cycling, FSH production by the pituitary gland, wound healing, extracellular matrix production, immunosuppression and carcinogenesis. Activin is also thought to have a paracrine or autocrine role in follicular development in the ovary. Within the receptor complex, type-2 receptors (ACVR2A and/or ACVR2B) act as a primary activin receptors whereas the type-1 receptors like ACVR1B act as downstream transducers of activin signals. Activin binds to type-2 receptor at the plasma membrane and activates its serine-threonine kinase. The activated receptor type-2 then phosphorylates and activates the type-1 receptor such as ACVR1B. Once activated, the type-1 receptor binds and phosphorylates the SMAD proteins SMAD2 and SMAD3, on serine residues of the C-terminal tail. Soon after their association with the activin receptor and subsequent phosphorylation, SMAD2 and SMAD3 are released into the cytoplasm where they interact with the common partner SMAD4. This SMAD complex translocates into the nucleus where it mediates activin-induced transcription. Inhibitory SMAD7, which is recruited to ACVR1B through FKBP1A, can prevent the association of SMAD2 and SMAD3 with the activin receptor complex, thereby blocking the activin signal. Activin signal transduction is also antagonized by the binding to the receptor of inhibin-B via the IGSF1 inhibin coreceptor. ACVR1B also phosphorylates TDP2.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.