Pm20d1 (NM_178079) Mouse Untagged Clone

CAT#: MC217050

Pm20d1 (untagged) - Mouse peptidase M20 domain containing 1 (Pm20d1), (10ug)

USD 639.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Pm20d1 (NM_178079) Mouse Untagged Clone
Symbol Pm20d1
Synonyms 4732466D17Rik; AI098026
Vector pCMV6-Entry
Sequence Data
>MC217050 representing NM_178079
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGAGCTACTTGCTAGCTTGCCCGCCTGGGCAGCTGTGCTCCTTCTCTTTTTCGCTACGGTCTCCG
GATCCACTGGCCCTAGAAGCAGGGAAAATCGGGGGGCGTCCCGGATCCCTTCCCAGTTCAGCGAGGAGGA
GCGTGTCGCTATAAAAGAGGCGCTGAAAGGTGCCATCCAGATTCCCACAGTGTCTTTCAGCCACGAGGAA
TCCAACACCACAGCCCTTGCTGAGTTTGGAGAATATATCCGCAAAGCCTTCCCTACAGTGTTCCACAGCA
GCCTTGTCCAACATGAAGTCGTGGCAAAGTATAGCCACCTGTTCACCATCCAAGGCTCAGACCCCAGTTT
GCAGCCCTACATGCTGATGGCTCACATTGATGTGGTTCCTGCCCCGGAAGAAGGATGGGAGGTGCCCCCG
TTCTCAGGCCTGGAACGCAATGGCTTCATCTATGGCCGGGGTGCGCTGGACAACAAAAACTCTGTGATGG
CGATCCTGCATGCTTTGGAGCTCCTGTTGATCAGAAACTACAGCCCCAAAAGATCTTTCTTCATTGCTTT
GGGCCATGATGAGGAGGTGTCCGGGGAAAAGGGGGCTCAGAAGATCTCAGCACTCTTACAGGCAAGGGGT
GTCCAGCTAGCCTTCCTTGTGGATGAAGGGAGCTTTATCTTGGAAGGCTTCATTCCAAACCTCGAGAAGC
CAGTTGCCATGATTTCAGTCACTGAGAAGGGTGCCCTTGACCTCATGCTGCAAGTAAACATGACTCCAGG
CCACTCTTCAGCTCCCCCAAAGGAGACAAGCATTGGCATTCTTTCTGCCGCTGTCAGCCGACTGGAGCAG
ACACCAATGCCGAATATGTTTGGAGGAGGGCCATTGAAGAAGACAATGAAGCTACTGGCAAATGAGTTTT
CCTTCCCTATCAATATAGTCTTGAGAAACCTGTGGCTATTTCATCCCATTGTGAGCAGGATAATGGAGAG
GAACCCCATAACAAATGCGCTGGTCCGAACTACCACAGCCCTCACCATGTTCAATGCAGGAATCAAGGTG
AATGTCATCCCTCCATTGGCTCAGGCTACAATCAACTGCCGAATTCACCCTTCGCAGACAGTACATGAGG
TCCTAGAACTTGTCAAGAACACCGTGGCTGATGACAGAGTCCAGCTGCATGTGTTGAGATCCTTTGAACC
CCTGCCCATCAGCCCCTCTGATGACCAGGCCATGGGCTACCAGCTGCTTCAAGAGACCATACGATCTGTC
TTCCCGGAAGTCGACATCGTCGTCCCCGGTATTTGTATTGCCAATACGGACACCCGACACTATGCCAACA
TCACCAATGGCATGTACCGGTTCAACCCCCTTCCCCTGAACCCTCAGGACTTCAGTGGTGTCCATGGAAT
CAATGAGAAAGTTTCCGTTCAGAACTACCAGAACCAGGTGAAGTTCATCTTTGAGTTCATCCAAAATGCC
GACACTTACAAAGAGCCAGTTCCTCATCTGCATGAACTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_178079
ORF Size 1512 bp
Insert Size 1512
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_178079.3, NP_835180
RefSeq Size 3540
RefSeq ORF 1512
Locus ID 212933
Cytogenetics 1|1 E4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.