Ccdc105 (NM_027630) Mouse Untagged Clone

CAT#: MC217012

Ccdc105 (untagged) - Mouse coiled-coil domain containing 105 (Ccdc105), (10ug)

USD 639.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ccdc105 (NM_027630) Mouse Untagged Clone
Symbol Ccdc105
Synonyms 4931413A09Rik
Vector pCMV6-Entry
Sequence Data
>MC217012 representing NM_027630
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTGTGTTGCTCCCTTCCACCGACCCGGGCCAGGACTCGCGCGTTGGGGCTCCAGAATGGCGCCAGG
CGGCCAAGGCCACGTCTCGCAAGGCACACCTTCTGACCGATCGCTGTGGGCAGGAGGCGGTGACCATGTG
GCAGCCCAAGGACAGTGTACTGGACCCGAACGTGGCACACCACCTGGGCCGCGCCGCCTACATGGAACCC
TGGCGCTTTCGGGTAGAGATGCTCAAAGGGGGCGGCACCCTGGAAAAGCCACCGCCCGGAGAAGGCGTCA
CCCTATGGAAAGGGAAGATGAAGCCCCCGGCCTGGTACGCGCGCCTACCGCTGCCTATGCACCGCGACGC
GCGTGCCCAGCAAACCGCCGAGGTGGTGCACGCGCACGCACGCGGGGCGCGCCTCACCGCCGCCCGCCTG
GGCCGCGCACAGCACCAGATCAATGGGCAGCTGCGGCTGCTGCTGCGCCAGCGCGAGGCCACTGACCGCA
GGCTCAGCGAGGTGCGCAAGGGCCTGCTCATCAATCAGCAGAGCGTCAAGTTGCGGGGCTACCGACCTAA
GTGTGAGAAGATCCCAGACAAGGCTGACAGCTTGCTTGTCTGGGAGAAAAAGGAACTGAAGTCCATGAAG
AGAAAAATGGAGAAGGACATGGAAATATCGGAGGACTTGCTCAAGGCTCTGGCCTCCTGCAGGGACACTC
TGGACTTCTACTGTCAGGAAAGGCTGCAAGCTGTGGAACTCATGAACCAGCCACTGGACAAAGTTCTGGA
GCAGGCTGGCCGCCACTCGTGGGTAGACATCACCCGACCCCCAACTCCTCGAACTCAGGGCTTGAAAACG
CCTCCTCCTGACCCCATTGGCACATATACCCCAGCGTGTGCTAAGGCCTTGTTTGAAGCCAAGCGCTTGT
TGATGGAGTCCAAAGACATCTTAACAGAGATGGCAAAGAATGAGGTGGACATTCAAAATCAACAACAGGA
GATAAGCAACCGTGTATGCTCCTCGCTGGCACAGAAGATGCGTGAGACCTTGGAGTTGAAGGAAAGAATG
ACCATGACTTTGGGGCTAATGAGGGGGACTATCCACCGGTGCATGAAATTCAATCAAGAGATGTACGTCA
CGCGGGGCATCATCAAGGGTCCTCTGTTGAAAAGGAACCTGGAGGCGCGAGAGAAACTGAACAGACCCTT
GGTTCGCATGTATCAGAGACACGTGGGCACCCAGCTCCCCGAGGCTACTCGCCTTGCCCAGGGTACTGAC
CTGCTGACCCGCCACAACTTGCACATGGAAAAGAATTTAAAAGAGCTCCGTACAACACACGATAACCTCG
CCTGGGGCCTCAACTGCAAAAAGATAGGGCACGATGTGGACTACGATGTGGTGCGTCTGCGCCTACGCCA
GCGCCACCCGCACGTGTGCTATGAGCAAGCGCAGCGCCTGGTCAACGACTGGGACCCTCCCACACCAGCG
CGCAGCCAAACCAATACCGCCTCCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_027630
ORF Size 1500 bp
Insert Size 1500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_027630.1, NP_081906
RefSeq Size 1718
RefSeq ORF 1500
Locus ID 70976
Cytogenetics 10|10 C1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.