OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Txnrd1 (NM_001042514) Mouse Untagged Clone

Be the first to review this product
SKU
MC216994
Txnrd1 (untagged) - Mouse thioredoxin reductase 1 (Txnrd1), transcript variant 4, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
AAV Particle:
DDK
  $770.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Txnrd1 or NM_001042514"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Txnrd1
Synonyms T; TR; TR1; Trx; TrxR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC216994 representing NM_001042514
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATGGCTCCAAAGATCCCCCTGGGTCCTATGACTTCGACCTGATCATCATTGGAGGAGGCTCAGGAG
GACTGGCAGCAGCTAAGGAGGCAGCCAAATTTGACAAGAAAGTGCTGGTCTTGGATTTTGTCACACCGAC
TCCTCTTGGGACCAGATGGGGTCTCGGAGGAACGTGTGTGAATGTGGGTTGCATACCTAAGAAGCTGATG
CACCAGGCAGCTTTGCTCGGACAAGCTCTGAAAGACTCGCGCAACTATGGCTGGAAAGTCGAAGACACAG
TGAAGCATGACTGGGAGAAAATGACGGAATCTGTGCAGAGTCACATCGGCTCGCTGAACTGGGGCTACCG
CGTAGCTCTCCGGGAGAAAAAGGTCGTCTATGAGAATGCTTACGGGAGGTTCATTGGTCCTCACAGGATT
GTGGCGACAAATAACAAAGGTAAAGAAAAAATCTATTCAGCAGAGCGGTTCCTCATCGCCACAGGTGAGA
GGCCCCGCTACCTGGGCATCCCTGGAGACAAAGAGTACTGCATCAGCAGTGATGATCTTTTCTCCTTGCC
TTACTGCCCGGGGAAGACCCTAGTAGTTGGTGCATCCTATGTCGCCTTGGAATGTGCAGGATTTCTGGCT
GGTATCGGCTTAGACGTCACTGTAATGGTGCGGTCCATTCTCCTTAGAGGATTTGACCAAGACATGGCCA
ACAAAATCGGTGAACACATGGAAGAACATGGTATCAAGTTTATAAGGCAGTTCGTCCCAACGAAAATTGA
ACAGATCGAAGCAGGAACACCAGGCCGACTCAGGGTGACTGCTCAATCCACAAACAGCGAGGAGACCATA
GAGGGCGAATTTAACACAGTGTTGCTGGCGGTAGGAAGAGATTCTTGTACGAGAACTATTGGCTTAGAGA
CCGTGGGCGTGAAGATAAACGAAAAAACCGGAAAGATACCCGTCACGGATGAAGAGCAGACCAATGTGCC
TTACATCTACGCCATCGGTGACATCCTGGAGGGGAAGCTAGAGCTGACTCCCGTAGCCATCCAGGCGGGG
AGATTGCTGGCTCAGAGGCTGTATGGAGGCTCCAATGTCAAATGTGACTATGACAATGTCCCAACGACTG
TATTTACTCCTTTGGAATATGGCTGTTGTGGCCTCTCTGAAGAAAAAGCCGTAGAGAAATTTGGGGAAGA
AAATATTGAAGTTTACCATAGTTTCTTTTGGCCATTGGAATGGACAGTCCCATCCCGGGATAACAACAAA
TGTTATGCAAAAATAATCTGCAACCTTAAAGACGATGAACGTGTCGTGGGCTTCCACGTGCTGGGTCCAA
ACGCTGGAGAGGTGACGCAGGGCTTTGCGGCTGCGCTCAAGTGTGGGCTGACTAAGCAGCAGCTGGACAG
CACCATCGGCATCCACCCGGTCTGTGCAGAGATATTCACAACGTTGTCAGTGACGAAGCGCTCTGGGGGA
GACATCCTCCAGTCTGGCTGCTGAGGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001042514
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042514.1, NP_001035979.1
RefSeq Size 3505 bp
RefSeq ORF 1500 bp
Locus ID 50493
UniProt ID Q9JMH6
Cytogenetics 10 C1
Summary The protein encoded by this gene belongs to the pyridine nucleotide-disulfide oxidoreductase family, and is a member of the thioredoxin (Trx) system. Three thioredoxin reductase (TrxR) isozymes are found in mammals. TrxRs are selenocysteine-containing flavoenzymes, which reduce thioredoxins, as well as other substrates, and play a key role in redox homoeostasis. This gene encodes an ubiquitously expressed, cytosolic form of TrxR, which functions as a homodimer containing FAD, and selenocysteine (Sec) at the active site. Sec is encoded by UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternative splicing, primarily at the 5' end, results in transcript variants encoding same or different isoforms. provided by RefSeq, May 2017
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1-3 encode the same isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001042514" in other vectors (1)
SKU Description Size Price
MR208008 1300018J18Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1300018J18 gene (1300018J18Rik), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) 10 ug
$289.00 $457.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products