Kcna2 (NM_008417) Mouse Untagged Clone

CAT#: MC216959

Kcna2 (untagged) - Mouse potassium voltage-gated channel, shaker-related subfamily, member 2 (Kcna2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Kcna2
• Synonyms: Akr6a4; ENSMUSG00000074335; Gm10672; Kca1-2; Kv1.2; Mk-2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_008417, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACAGTGGCTACCGGAGACCCAGTGGACGAGGCTGCTGCCCTCCCTGGGCACCCACAAGACACCTATG
  ACCCAGAGGCAGACCATGAATGCTGTGAGAGAGTGGTCATCAACATCTCAGGCCTGCGGTTCGAAACTCA
  GCTAAAGACCTTAGCCCAGTTCCCAGAGACCCTCTTAGGGGACCCCAAGAAACGGATGAGGTACTTCGAT
  CCCCTCCGAAATGAGTACTTTTTTGATCGCAACCGCCCTAGCTTTGATGCCATTTTGTACTACTATCAGT
  CTGGGGGCAGGTTGAGGCGACCTGTGAACGTGCCCTTAGATATCTTCTCGGAAGAAATCCGGTTTTATGA
  GCTAGGAGAAGAAGCAATGGAGATGTTTCGGGAGGATGAAGGCTACATCAAGGAAGAAGAGCGTCCTCTG
  CCTGAAAATGAGTTTCAGAGACAGGTGTGGCTTCTCTTTGAATACCCTGAGAGCTCAGGGCCTGCCAGGA
  TTATAGCCATTGTATCTGTGATGGTCATTCTGATCTCCATCGTCAGCTTCTGTCTGGAAACCTTGCCCAT
  CTTCCGGGATGAGAATGAGGACATGCATGGTGGCGGGGTGACCTTCCACACCTATTCCAACAGCACCATC
  GGGTACCAGCAGTCCACCTCCTTCACCGACCCTTTCTTCATTGTAGAGACTCTCTGCATCATCTGGTTCT
  CCTTTGAGTTTCTGGTTAGATTCTTTGCCTGTCCCAGCAAAGCTGGCTTCTTCACCAACATCATGAACAT
  CATTGACATTGTGGCTATCATCCCTTACTTTATCACCCTGGGGACAGAGTTAGCTGAGAAGCCAGAGGAT
  GCCCAGCAAGGCCAGCAGGCCATGTCACTGGCCATTCTCCGTGTCATCCGGTTGGTAAGAGTCTTTAGGA
  TTTTCAAGTTGTCCAGACACTCCAAAGGTCTACAGATTCTAGGTCAGACCCTCAAAGCTAGCATGAGGGA
  ATTGGGCCTCCTGATATTCTTCCTCTTCATTGGGGTCATCCTCTTCTCTAGTGCTGTCTATTTTGCAGAA
  GCTGATGAGAGAGATTCCCAGTTCCCCAGCATCCCGGATGCTTTCTGGTGGGCAGTCGTCTCCATGACAA
  CTGTAGGCTATGGAGACATGGTTCCAACTACCATTGGGGGGAAGATAGTGGGTTCTCTGTGTGCAATTGC
  AGGTGTGTTAACCATTGCCTTACCAGTCCCTGTCATAGTGTCTAATTTCAACTACTTCTACCACCGGGAG
  ACAGAGGGAGAGGAGCAGGCCCAGTACTTGCAAGTGACAAGCTGTCCAAAGATCCCGTCCTCCCCTGACC
  TAAAGAAAAGTAGAAGTGCCTCTACCATAAGTAAGTCTGATTACATGGAGATACAGGAGGGAGTTAACAA
  CAGCAATGAGGACTTTAGAGAGGAGAACTTAAAAACAGCCAACTGTACCTTGGCTAACACAAACTATGTG
  AATATTACCAAAATGTTAACTGATGTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_008417
• Insert Size: 1500 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC138650, AAI38651
• RefSeq Size: 2832 bp
• RefSeq ORF: 1500 bp
• Locus ID: 16490
• UniProt ID: P63141
• Cytogenetics: 3 46.61 cM
• Gene Summary: Voltage-gated potassium channel that mediates transmembrane potassium transport in excitable membranes, primarily in the brain and the central nervous system, but also in the cardiovascular system. Prevents aberrant action potential firing and regulates neuronal output. Forms tetrameric potassium-selective channels through which potassium ions pass in accordance with their electrochemical gradient. The channel alternates between opened and closed conformations in response to the voltage difference across the membrane (PubMed:12527813, PubMed:21233214). Can form functional homotetrameric channels and heterotetrameric channels that contain variable proportions of KCNA1, KCNA2, KCNA4, KCNA5, KCNA6, KCNA7, and possibly other family members as well; channel properties depend on the type of alpha subunits that are part of the channel (PubMed:20696761). Channel properties are modulated by cytoplasmic beta subunits that regulate the subcellular location of the alpha subunits and promote rapid inactivation of delayed rectifier potassium channels (By similarity). In vivo, membranes probably contain a mixture of heteromeric potassium channel complexes, making it difficult to assign currents observed in intact tissues to any particular potassium channel family member. Homotetrameric KCNA2 forms a delayed-rectifier potassium channel that opens in response to membrane depolarization, followed by slow spontaneous channel closure (PubMed:23864368). In contrast, a heteromultimer formed by KCNA2 and KCNA4 shows rapid inactivation (PubMed:23864368). Contributes to the regulation of action potentials in neurons (PubMed:12527813, PubMed:17925011). KCNA2-containing channels play a presynaptic role and prevent hyperexcitability and aberrant action potential firing (PubMed:17634333, PubMed:17925011). Response to toxins that are selective for KCNA1, respectively for KCNA2, suggests that heteromeric potassium channels composed of both KCNA1 and KCNA2 play a role in pacemaking and regulate the output of deep cerebellar nuclear neurons (By similarity). Response to toxins that are selective for KCNA2-containing potassium channels suggests that in Purkinje cells, dendritic subthreshold KCNA2-containing potassium channels prevent random spontaneous calcium spikes, suppressing dendritic hyperexcitability without hindering the generation of somatic action potentials, and thereby play an important role in motor coordination (By similarity). KCNA2-containing channels play a role in GABAergic transmission from basket cells to Purkinje cells in the cerebellum, and thereby play an import role in motor coordination (PubMed:20696761). Plays a role in the induction of long-term potentiation of neuron excitability in the CA3 layer of the hippocampus (PubMed:23981714). May function as down-stream effector for G protein-coupled receptors and inhibit GABAergic inputs to basolateral amygdala neurons (By similarity). May contribute to the regulation of neurotransmitter release, such as gamma-aminobutyric acid (GABA) (By similarity). Contributes to the regulation of the axonal release of the neurotransmitter dopamine (PubMed:21233214). Reduced KCNA2 expression plays a role in the perception of neuropathic pain after peripheral nerve injury, but not acute pain (By similarity). Plays a role in the regulation of the time spent in non-rapid eye movement (NREM) sleep (PubMed:17925011).[UniProtKB/Swiss-Prot Function]