Kcng2 (NM_001190373) Mouse Untagged Clone

CAT#: MC216730

Kcng2 (untagged) - Mouse potassium voltage-gated channel, subfamily G, member 2 (Kcng2), (10ug)

USD 618.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Kcng2 (NM_001190373) Mouse Untagged Clone
Symbol Kcng2
Synonyms AA591524
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC216730 representing NM_001190373
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCGGCTCCTGGGGCACCCGGAGGCCCCCGACGCGGAGCCTGGCAGCGCAGGCCGACGGGGCCGTG
GCGGCCGCGGGGCCCGGGCGCGCCACGTCATTATCAACGTCGGGGGCTGCAGGGTGCGTCTGGCCTGGGC
CGCGCTGGCCCGCTGTCCCCTGGCGCGCCTCGAGCGCCTGCGAGCCTGCCGCGGCCACGACGAGCTGCTG
CGCGTGTGTGACGACTACGACGTGAGCCGCGACGAGTTCTTCTTCGACCGCAGCCCGTGCGCTTTCCGCG
CCATCGTGGCGCTGCTGCGCGCCGGCAAGCTAAGGCTGCTGCGCGGCCCGTGCGCCCTGGCCTTCCGCGA
CGAGCTGGCCTACTGGGGCATCGACGAGGCGCGGCTGGAGCGCTGCTGCCTGCGCCGCCTGCGCCGCCGC
GAGGAGGAGGCCGCCGAGGCCAGCGCCGCGCAGCCCGCCCGAGGGCCGCCGACCAGCCCCGGCCGAGCCC
TGGGCAGCGGGCGGCTGGAGCGAGGCCGACAGCGCCTGCGCGACGTGGTGGAGAACCCGCACTCCGGGCT
GGCGGGCAGGCTCTTCGCCTACGTCTCCGTGGCCTTCGTGGCCGTCACAGCCGTCGGCCTGTGCCTGAGC
ACCATGCCGGACGTCCGCGCAGAAGAGGAACGGGGCGAGTGCTCCACAAAGTGCCGCAACCTGTTCGTGC
TGGAGACGGTGTGCGTGGCCTGGTTCTCCTTCGAGTTCCTGCTGCGCTCCCTGCAGGCTGAGAGCAAGTG
CGCCTTCCTCCGGACGCCGCTTGCCATCATCGACATCCTGGCCATCCTGCCCTTCTACGTGTCGCTGCTC
GCGGGACTGGCGGCAGGGCCCACGGGCAGCAAGATGCTGGAGCGCGCGGGTCTGGTGCTGCGGCTGCTGC
GGGCGCTGCGCGTGCTCTACGTGATGCGCCTGGCGCGCCACTCGTTGGGGCTGCGCTCGCTTGGCCTCAC
CGTGCGCCGCTGCGCACGCGAGTTCGGACTGCTGCTGCTCTTCCTCTGCGTGGCCATGGCGCTCTTCGCG
CCGCTCGTGCACCTGGCTGAGCGCGAGCTGGGCGCTCACCGCGACTTCTCCAGCGTCCCCGCCAGCTACT
GGTGGGCAGTCATCTCCATGACCACCGTGGGCTATGGAGACATGGTGCCGCGCAGCCTTCCGGGCCAGGT
GGTGGCGCTGAGCAGCATCCTCAGCGGCATCCTGCTCATGGCCTTCCCTGTCACCTCCATCTTCCACACC
TTCTCGCGCTCCTATTCGGAGCTCAAGGAGCAGCAACAGCGCGCGGCCAGCCCTGAACCGGCCCTGCGCG
AGGACAGCACGCGTGATGACAGTACACGTTCGGCCAGCGCCACTGAGGACAGCTCTCAGGACCCTGAGAC
CGCAGGCGCGGCAGGGAGCTTGCCGGGCCGGGTGGGACCCTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN NM_001190373
ORF Size 1443 bp
Insert Size 1443
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001190373.1, NP_001177302
RefSeq Size 2815
RefSeq ORF 1443
Locus ID 240444
Cytogenetics 18|18 E3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.