Pacsin2 (NM_001159510) Mouse Untagged Clone

CAT#: MC216657

Pacsin2 (untagged) - Mouse protein kinase C and casein kinase substrate in neurons 2 (Pacsin2), transcript variant 3, (10ug)

  View "NM_001159510" in other vectors (6)

USD 640.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Pacsin2 (NM_001159510) Mouse Untagged Clone
Symbol Pacsin2
Synonyms AI197433
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC216657 representing NM_001159510
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGTCACCTACGATGACTCTGTGGGAGTGGAAGTGTCCAGCGACAGCTTCTGGGAGGTTGGGAACT
ACAAACGGACTGTGAAGCGGATTGACGATGGCCACCGCCTGTGTGGTGACCTCATGAACTGTCTGCATGA
GCGGGCACGCATCGAGAAGGCGTATGCACAGCAGCTCACTGAGTGGGCCCGACGCTGGAGGCAGCTGGTA
GAGAAGGGACCACAGTATGGGACCGTGGAGAAGGCCTGGATAGCTGTCATGTCTGAAGCAGAGAGGGTGA
GTGAACTGCACCTGGAAGTGAAGGCATCACTGATGAATGAAGACTTTGAGAAGATCAAGAACTGGCAGAA
GGAAGCCTTTCACAAGCAGATGATGGGAGGCTTCAAGGAGACCAAAGAAGCAGAGGATGGCTTTCGGAAG
GCCCAGAAGCCCTGGGCCAAGAAGCTGAAAGAGGTGGAAGCGGCAAAGAAGGCGCACCACACAGCGTGCA
AAGAGGAGAAGCTGGCCATCTCCCGGGAAGCCAACAGCAAGGCAGATCCATCCCTCAACCCTGAGCAGCT
GAAGAAACTGCAAGACAAGATAGAAAAATGCAAACAGGACGTTCTAAAGACCAAGGACAAGTATGAGAAG
TCCCTGAAGGAGCTTGATCAGACCACACCCCAGTACATGGAGAACATGGAGCAGGTGTTCGAGCAGTGCC
AGCAGTTTGAAGAGAAGCGCCTGCGCTTCTTCCGGGAGGTTCTGCTGGAGGTTCAGAAGCACTTGGATCT
GTCCAATGTGGCTAGCTATAAAACCATTTACCGGGAGCTGGAGCAGAGCATCAAAGCAGCAGATGCGGTA
GAGGACCTGAGGTGGTTCCGGGCTAACCATGGGCCAGGCATGGCTATGAACTGGCCACAGTTTGAGGAGT
GGTCTGCAGATCTGAATCGAACTCTCAGCCGGAGAGAGAAGAAGAAGGCTGTTGACGGTGTCACCCTAAC
AGGGATCAACCAGACAGGTGACCAGTCTGGACAGAACAAGCCTGGCAGCAACCTTAGTGTCCCGAGCAAC
CCCGCCCAGTCCACGCAGTTACAGTCCAGCTACAACCCCTTCGAGGACGAGGACGACACGGGCAGCAGCA
TCAGTGAGAAGGAGGACATTAAGGCCAAAAATGTCAGCAGCTATGAGAAGACTCAGACTTACCCCACTGA
CTGGTCTGATGATGAGTCTAACAACCCTTTCTCCTCCACGGATGCCAACGGGGATTCGAACCCATTTGAT
GAGGACACGACCTCAGGAACAGAAGTGCGAGTTCGGGCCCTCTATGACTATGAGGGGCAGGAACATGATG
AGCTGAGCTTCAAGGCTGGGGATGAACTGACCAAGATAGAGGATGAAGATGAACAGGGTTGGTGCAAGGG
ACGTTTAGACAGCGGCCAGGTTGGCCTATACCCAGCCAACTATGTCGAGGCTATCCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001159510
ORF Size 1461 bp
Insert Size 1461
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001159510.1, NP_001152982
RefSeq Size 3644
RefSeq ORF 1461
Locus ID 23970
Cytogenetics 15|15 E1

Other Versions

Other products for "Pacsin2"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones