Sf3a2 (NM_013651) Mouse Untagged Clone

CAT#: MC216647

Sf3a2 (untagged) - Mouse splicing factor 3a, subunit 2 (Sf3a2), (10ug)

  View "NM_013651" in other vectors (1)

USD 640.00


Availability*
5 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Sf3a2 (NM_013651) Mouse Untagged Clone
Symbol Sf3a2
Synonyms 66kDa; AW047242; PRP11; Sap62; SFA66
Vector pCMV6-Entry
Sequence Data
>MC216647 representing NM_013651
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACTTTCAGCACAGACCTGGAGGCAAGACTGGGAGTGGGGGCGTAGCCTCCTCCTCTGAGAGCAACC
GGGATCGGAGAGAGCGTCTGCGCCAATTGGCCCTGGAAACCATTGACATCAACAAGGACCCGTATTTTAT
GAAGAACCACTTGGGATCCTATGAGTGCAAACTCTGCCTGACTCTGCATAACAATGAGGGGAGCTACCTG
GCCCATACCCAAGGGAAGAAACATCAGACTAACTTGGCCCGGCGAGCTGCCAAGGAGGCCAAAGAAGCCC
CCGCCCAGCCTGCACCGGAGAAGGTCAAGGTGGAGGTGAAGAAGTTTGTGAAGATTGGCCGCCCTGGGTA
CAAAGTGACCAAGCAGAGGGACACAGAGATGGGCCAGCAGAGCCTGCTGTTCCAGATTGACTACCCTGAG
ATCGCAGAGGGTATCATGCCACGCCACCGTTTCATGTCTGCTTATGAGCAGAGGATCGAGCCTCCAGACC
GCCGCTGGCAGTACCTGCTCATGGCTGCTGAGCCCTATGAGACCATTGCTTTCAAGGTGCCAAGCCGGGA
GATTGACAAGGCTGAGGGCAAGTTTTGGACCCACTGGAACAGAGAAACCAAGCAGTTTTTTCTTCAGTTC
CACTTTAAGATGGAGAAGCCCCCAGCACCTCCCAGCCTCCCAGCAGGACCCCCAGGCGTCAAGCGGCCCC
CGCCCCCACTCATGAATGGACTGCCTCCTCGCCCACCACTCCCTGATGCCTTGCCCCCACCTCCACCTGG
TGGCCTGCCTCTCCCTCCTATGCCCCCCACTGGGCCTGCTCCCTCTGGGCCCCCTGGACCTCCCCAGATG
CCCCCACCAGCTCCTGGGGTGCACCCCCCGGCCCCAGTAGTACACCCACCAACATCTGGAGTCCATCCCC
CAGCTCCTGGGGTACACCCCCCAGCACCAGTGGTCCATCCACCAACATCTGGGGTCCATCCCCCAGCCCC
TGGAGTGCACCCACCCACCCCTGGAGTGCACCCACCAGCCCCAGGAGTGCACCCACCAGCTCCAGGTGTC
CACCCACCAGCTCCAGGGGTACACCCCCCAACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCAC
CAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTACACCCTCCTCCATCAGCTGGAGTTCATCCTCAGGC
TCCAGGGGTACACCCACCTGCTCCTGCAGTACACCCTCAAGCCCCTGGGGTACACCCCCCAGCCCCTGGG
ATCCACCCTCAGGCACCAGGGGTTCACCCTCAGCCGCCTCCTGGAGTCCACCCTGCTGCCCCGGGGGTCC
ACCCTCAGCCTCCAGGGGTTCACCCCTCAAATCCTGGGGTGCACCCTGCTCCTATGCCCCCCATGCTGAG
GCCCCCACTCCCCTCAGATGGCCCTGGGAACATGCCTCCCCCTCCCCCAGGCAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_013651
ORF Size 1458 bp
Insert Size 1458
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_013651.4, NP_038679
RefSeq Size 1674
RefSeq ORF 1458
Locus ID 20222
Cytogenetics 10 C1|10 39.72 cM

Other Versions

Other products for "Sf3a2"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies