Oc90 (NM_010953) Mouse Untagged Clone

CAT#: MC216637

Oc90 (untagged) - Mouse otoconin 90 (Oc90), (10ug)

USD 618.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Oc90 (NM_010953) Mouse Untagged Clone
Symbol Oc90
Synonyms oc95; Ocn-95; PLA2L; Pla2ll
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC216637 representing NM_010953
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTATGCTGCTCATGGTCGGTATGCTGATGGCCCCCTGTGTTGGGGCCCATGCTCTGGACACACCAA
ATCCCCAGGAATTGCCTCCAGGACTGTCAAAAAATATAAATATCACTTTCTTCAATGGAGTGTTTAAAAA
CGTGGAAAGTGTGGCTGAAATTTTTGACTGCCTAGGTTCCCACTTCACCTGGCTGCAGGCTGTCTTCACC
AACTTCCCGCTGCTCCTCCAGTTTGTAAACAGTATGAGGTGTGTAACTGGCCTCTGCCCCCGGGACTTTG
AAGACTATGGTTGTGCCTGTAGGTTTGAGATGGAAGGGATGCCTGTGGACGAGTCTGATATCTGCTGCTT
CCAGCATCGCAGGTGCTATGAGGAAGCTGTTGAGATGGACTGTCTCCAAGACCCTGCCAAGCTCAGTGCA
GATGTGGATTGCACCAACAAACAGATCACATGTGAGTCCGAGGATCCCTGTGAGCGTCTACTGTGTACGT
GTGACAAGGCTGCTGTGGAGTGCCTGGCTCAGTCTGGCATCAACTCCTCCCTGAACTTCCTGGATGCTTC
CTTCTGCCTCCCTCAGACTCCAGAGACAACTAGTGGGAAGGCTGCAACACTGTTGCCTAGAGGGATTCCT
GAAAAGCCCACAGATACCAGTCAGATAGCCCTGTCAGGAGAAGTGGCTGGTGAGGTGAGAGCAGACACAC
TAACAACCCTCTCCAGAACAAAGTCTGTTCAAGATCTTCAAGACACACAAGCTTCTAGGACCACATCAAG
TCCAGGATCTGCAGAGATTATTGCCCTAGCCAAAGGTACAACCCACTCTGCTGGCATCAAACCACTGAGG
TTGGGAGTCTCATCTGTTGACAATGGTTCCCAGGAAGCAGCTGGAAAAGCCTGTGACAGATTGGCCTTCG
TGCATCTGGGTGATGGGGACAGCATGACGGCCATGCTGCAGCTTGGAGAGATGCTCTTCTGTCTAACATC
CCATTGCCCAGAGGAATTTGAAACTTACGGCTGCTACTGTGGAAGAGAAGGAAGAGGAGAGCCAAGGGAC
ACCCTGGATAGGTGCTGTCTGTCCCATCACTGCTGTTTGGAGCAGATGAGACAAGTGGGCTGCCTCCATG
GAAGGCGTTCTCAGTCATCTGTGGTATGTGAAGACCACATGGCCAAATGTGTGGGGCAGAGCCTGTGTGA
GAAGCTACTATGTGCCTGTGACCAGATGGCAGCTGAGTGCATGGCCTCTGCCTTCTTTAATCAAAGCCTC
AAGTCACCAGACGGAGCCGAGTGTCAAGGCGAGCCTGTGTCCTGTGAGGATGGCATGCTCCAGGGCACCT
TGGCCTCTTCTGTGGACTCCAGTTCTGAGGAGAATAGTGAGGAAGCTCCACCGCAGATGGAACGCCTAAG
AAGATTTCTGGAAAAGCCTCCTGGTCCCTTGGGGGCCAGACCCCTCGGTGGGAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_010953
ORF Size 1458 bp
Insert Size 1458
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_010953.2, NP_035083
RefSeq Size 1799
RefSeq ORF 1458
Locus ID 18256
Cytogenetics 15 D1|15 29.16 cM
Gene Summary Major protein of the utricular and saccular otoconia. It is unlikely that this protein has phospholipase A2 activity. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.