Gpatch2l (NM_027405) Mouse Untagged Clone

CAT#: MC216601

Gpatch2l (untagged) - Mouse RIKEN cDNA 1700020O03 gene (1700020O03Rik), (10ug)

USD 618.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gpatch2l (NM_027405) Mouse Untagged Clone
Symbol Gpatch2l
Synonyms 1700020O03Rik; 4732487G21Rik; A630090I05Rik; Kiaa1152
Vector pCMV6-Entry
Sequence Data
>MC216601 representing NM_027405
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGAGCTAGTGCATGACCTGGCCTCAGCCTTGGAGCAGACATCGGAGCAGAGCAAGCTTGGTGAGC
TGTGGGAGGAGATGGCCCTGAGCCCCAGACAGCAGAGGCGGCAGCTTCGCAAACGCCGAGGACGGAAGCG
CCGGTCTGACTTTACTCACCTGGCAGAGCACGCCTGCTGCTTCAGCGAGGCCTCTGAGTCAAGTCTGGAT
GAAGCCACCAAGGACTGCCGAGAAGTGGCTCCGCTCACCAACTTCAGTGACTCTGATGACACGGTGGTGG
CCAAACGGCACCCAGCTCTCAGTGCCATCATTAGGGGTAAGCAACATTCTTGGCCCGAGTCTGACTCCTT
TACGGAAAACGCACCTTGTCGACCCCTCAGGCGCCGGCGGAAGGTGAAGCGAGTGACGTCCGAGGTGGCT
GCCAGCCTTCAGCAGAAGCTGAAAGTGTCAGATTGGAGCTATGAGAGAGGCTGCAGGTTCAAGTCTGCCA
AGAAGCAGCGTCTATCCCGCTGGAAGGAGAATACTCCCTGGACCTCATCTGGCCATGGGCTGTGTGAATC
AGCAGAGAATCGGACTTTCCTAAGCCAACCAGGAAGGAAAGAAAGGATGGAGTGCGAAGCCGAAGAGCAG
AAGCACGGCTCTGACGAGAACATGTCCGAGTGTGACACTAGCAGTGTGTGCAGCAGCAGTGACACGGGGC
TCTTCACCAATGATGAAGGACGACAAGGGGATGATGAGCAGAGTGATTGGTTTTATGAAGGAGAATGTGT
CCCCGGATTCACTGTCCATAACCTTCTGCCCAAGTGGGCTCCTGATCACTGCACTGAAGTAGAAAGGATG
GACTCCGGCCTGGATAAACTCTCAGACCCCACGTTCCTTTTACCTTCCCGGCCAGCTCAAAGAGGATACC
ATGGTCGTCTGAATAGGTTGCCAGGAGCTGCAGCTCGTTGCCTCAGGAAGGGGCGGAGAAGGCTGCCTGG
GAAGGAGGCGAGCATGAGCAGCCTGGGGACGGAGAGGATCGGCCATACCATCAGTGACCCCCGGCAGACA
GATTTCTGGTTACCATCAGCTGGGAAAAGAGAACGGAATCAGTTTAATCCACTCTCCCCTCTTTACTCCC
TGGACGTTCTTGCTGATGCTTCTCATCGAAGGTGCTCACCTGCACACTGCTCTGCCAGGCAGGCAAGTGT
ACACTGGGGACCACCATGTCCACGTGACATTAAGAGGAAACGGAAACCTGTGGCCTCAGCATCTTTTTCT
AGCCCTAGTCCAGTGCACCCAGATGTTCTGGAGCCGGCCATCCCAGCTCAGAAGCCTCCTGACTCCGAGT
GGTTGGACGGGACCTCTGCAGCAGAGAAAGCCACTGCCTTTCCTCCAGCCACGTTTTTCAAAATGCCACA
GGAAAAGAATTCTGGCTGCAGCTCTAGCCCAGGAACCAATGGGTGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_027405
ORF Size 1449 bp
Insert Size 1449
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_027405.3, NP_081681
RefSeq Size 3967
RefSeq ORF 1449
Locus ID 70373
Cytogenetics 12|12 D2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.