Htr2a (NM_172812) Mouse Untagged Clone

CAT#: MC216461

Htr2a (untagged) - Mouse 5-hydroxytryptamine (serotonin) receptor 2A (Htr2a), (10ug)


  "NM_172812" in other vectors (4)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Htr2a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Htr2a
Synonyms E030013E04; Htr-2; Htr2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216461 representing NM_172812
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAATTCTCTGTGAAGACAATATCTCCCTGAGCTCAATTCCAAACTCCTTAATGCAATTAGGTGACG
ACTCGAGGCTCTACCCTAATGACTTCAACTCCAGGGATGCTAACACTTCCGAAGCCTCGAACTGGACAAT
TGATGCTGAAAACAGAACCAACCTCTCCTGCGAAGGGTACCTCCCACCGACATGCCTCTCCATTCTTCAT
CTCCAGGAAAAAAACTGGTCTGCTTTATTGACAACTGTCGTGATTATTCTCACCATTGCGGGAAACATAC
TGGTCATCATGGCAGTGTCCCTAGAGAAAAAGCTGCAGAATGCCACCAACTATTTCCTGATGTCACTTGC
CATAGCTGATATGCTGCTGGGTTTCCTTGTCATGCCCGTGTCCATGTTAACCATCCTGTATGGGTACCGG
TGGCCTTTGCCCAGCAAGCTCTGTGCCGTCTGGATTTACCTGGATGTGCTCTTCTCCACGGCGTCCATCA
TGCACCTCTGCGCCATCTCCCTGGACCGCTACGTGGCTATCCAGAACCCCATTCACCATAGCCGCTTCAA
CTCCAGAACCAAAGCCTTCCTGAAAATCATTGCGGTGTGGACCATATCCGTAGGTATATCCATGCCAATC
CCAGTCTTCGGGCTACAGGATGATTCGAAGGTCTTTAAGGAAGGGAGCTGCCTGCTCGCCGATGACAACT
TTGTCCTCATAGGCTCTTTTGTGGCATTTTTCATCCCCCTAACCATCATGGTGATCACCTACTTCCTGAC
TATCAAGTCACTTCAGAAAGAAGCCACCTTGTGTGTGAGTGACCTCAGCACTCGGGCCAAATTATCCTCC
TTCAGCTTCCTCCCTCAGAGTTCTCTGTCATCAGAAAAGCTCTTCCAGCGGTCCATCCACAGAGAGCCAG
GCTCCTACGCAGGCCGAAGGACGATGCAGTCCATCAGCAACGAGCAAAAAGCATGCAAGGTGCTGGGCAT
CGTGTTCTTTCTGTTTGTTGTAATGTGGTGCCCATTCTTCATCACCAATATCATGGCCGTCATCTGCAAA
GAATCCTGCAATGAAAATGTCATTGGAGCCCTGCTCAATGTGTTTGTCTGGATTGGTTATCTCTCCTCAG
CCGTCAACCCACTGGTATATACGTTGTTCAATAAAACTTATAGGTCCGCCTTCTCACGGTACATTCAGTG
CCAGTACAAGGAGAACAGAAAGCCGCTGCAGTTAATTTTAGTGAACACTATACCAACATTGGCCTACAAG
TCTAGTCAGCTCCAGGTGGGACAAAAAAAGAACTCACAGGAAGATGCTGAGCCGACAGCTAATGACTGCT
CCATGGTTACACTAGGGAACCAACACTCGGAAGAGATGTGTACAGACAATATTGAAACCGTGAATGAAAA
GGTTAGCTGTGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_172812
Insert Size 1416 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC108972, AAI08973
RefSeq Size 1816 bp
RefSeq ORF 1416 bp
Locus ID 15558
UniProt ID P35363
Cytogenetics 14 39.37 cM
Gene Summary G-protein coupled receptor for 5-hydroxytryptamine (serotonin). Also functions as a receptor for various drugs and psychoactive substances, including mescaline, psilocybin, 1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane (DOI) and lysergic acid diethylamide (LSD). Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of down-stream effectors. Beta-arrestin family members inhibit signaling via G proteins and mediate activation of alternative signaling pathways. Signaling activates phospholipase C and a phosphatidylinositol-calcium second messenger system that modulates the activity of phosphatidylinositol 3-kinase and promotes the release of Ca(2+) ions from intracellular stores. Affects neural activity, perception, cognition and mood. Plays a role in the regulation of behavior, including responses to anxiogenic situations and psychoactive substances. Plays a role in intestinal smooth muscle contraction, and may play a role in arterial vasoconstriction.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.