Gabrg2 (NM_008073) Mouse Untagged Clone

CAT#: MC216456

Gabrg2 (untagged) - Mouse gamma-aminobutyric acid (GABA) A receptor, subunit gamma 2 (Gabrg2), transcript variant 1, (10ug)


  "NM_008073" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gabrg2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gabrg2
Synonyms GABAA-R; Gabrg-2; gamma2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216456 representing NM_008073
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTTCGCCAAATACATGGAGCATTGGAAGCTCAGTCTACTCTCCTGTATTTTCACAGAAAATGACGC
TGTGGATTCTGCTCCTGCTATCGCTCTACCCAGGCTTCACAAGCCAAAAGTCAGATGATGACTATGAAGA
TTACGCTTCTAATAAAACATGGGTGTTGACTCCAAAAGTTCCAGAGGGTGATGTCACTGTCATCTTAAAC
AACCTGCTGGAAGGGTATGACAACAAACTTCGACCTGACATCGGAGTGAAACCAACATTAATTCATACAG
ATATGTATGTGAACAGCATTGGTCCAGTGAATGCTATCAATATGGAATATACAATTGATATTTTTTTTGC
CCAAACCTGGTATGACAGACGTTTGAAATTTAACAGTACCATTAAAGTTCTCCGGTTGAATAGCAATATG
GTGGGGAAAATCTGGATTCCAGACACTTTCTTCAGGAACTCCAAAAAGGCTGATGCTCACTGGATCACCA
CTCCCAACAGGATGCTGAGAATTTGGAATGATGGTCGAGTTCTCTACACCTTAAGGCTAACAATTGATGC
TGAGTGCCAGTTGCAATTACACAACTTCCCAATGGATGAACACTCCTGCCCCCTGGAGTTCTCCAGTTAT
GGATATCCTCGTGAAGAAATTGTTTATCAATGGAAGCGCAGTTCTGTTGAAGTGGGTGACACAAGATCAT
GGAGGCTGTATCAATTTTCCTTTGTTGGATTGAGGAATACAACTGAAGTAGTGAAGACAACTTCTGGTGA
CTATGTGGTGATGTCTGTGTACTTCGATCTGAGCAGAAGAATGGGCTACTTCACCATCCAGACTTACATT
CCCTGCACACTCATCGTGGTCCTGTCCTGGGTGTCCTTCTGGATCAATAAGGATGCTGTTCCTGCCAGAA
CATCTTTAGGAATCACTACTGTCCTGACCATGACAACTTTAAGCACCATAGCCAGAAAATCTCTGCCCAA
GGTCTCCTATGTCACAGCAATGGATCTCTTTGTATCTGTTTGCTTCATCTTTGTGTTTTCTGCTTTGGTG
GAGTATGGCACCCTGCATTATTTTGTCAGCAACCGGAAGCCAAGCAAGGATAAAGACAAAAAGAAGAAAA
ACCCTCTTCTTCGGATGTTTTCCTTCAAGGCCCCTACCATTGATATTCGTCCCAGATCAGCAACCATTCA
AATGAACAATGCCACACACCTTCAAGAGAGGGATGAAGAATATGGCTATGAGTGTTTGGATGGCAAGGAC
TGTGCCAGTTTCTTCTGCTGTTTTGAAGATTGCCGAACAGGAGCCTGGAGACATGGGAGGATACATATTC
GCATTGCCAAAATGGACTCCTATGCTCGGATCTTCTTCCCTACCGCCTTTTGCTTGTTCAATCTTGTTTA
CTGGGTCTCCTATCTTTATCTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008073
Insert Size 1425 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC031762, AAH31762
RefSeq Size 2304 bp
RefSeq ORF 1425 bp
Locus ID 14406
UniProt ID P22723
Cytogenetics 11 24.8 cM
Gene Summary This gene encodes a gamma-aminobutyric acid (GABA)-A receptor subunit, which is a member of the ligand-gated ion channel family. GABA is the major inhibitory neurotransmitter in the adult central nervous system, and conversely exhibits an excitatory function during development. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. This gene encodes one of three gamma subunits in mammals, which contain the binding site for benzodiazepine drugs. Several mutations in this gene are associated with epileptic seizures, and genetic knockdown is associated with anxiety behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1, also known as gamma 2L). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.