Gabrb3 (NM_001038701) Mouse Untagged Clone

CAT#: MC216454

Gabrb3 (untagged) - Mouse gamma-aminobutyric acid (GABA) A receptor, subunit beta 3 (Gabrb3), transcript variant 2, (10ug)


  "NM_001038701" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gabrb3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gabrb3
Synonyms A230092K12Rik; AW049585; beta3; Cp1; Gabrb-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216454 representing NM_001038701
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGCTCCGGGCTCCAGGCCCTGCTGCTGCCAATCTGGCTTTCCTGGACCCTGGGGACGCGAGGATCTG
AGCCCAGCAGCGTAAACGACCCCGGGAACATGTCCTTTGTGAAGGAGACGGTCGACAAGCTGTTGAAAGG
CTACGACATTCGCCTGAGACCCGACTTCGGGGGTCCCCCAGTCTGCGTGGGGATGAACATCGACATCGCC
AGCATCGACATGGTTTCTGAAGTCAACATGGATTATACCTTAACTATGTATTTCCAACAATACTGGAGAG
ATAAAAGGCTCGCCTATTCTGGGATCCCTCTCAACCTCACGCTTGACAATCGAGTGGCTGACCAGCTCTG
GGTGCCCGACACATATTTCTTAAATGACAAAAAGTCATTTGTCCACGGAGTGACAGTGAAAAACCGCATG
ATCCGCCTCCACCCTGATGGGACAGTGCTGTATGGGCTCAGGATCACTACGACAGCAGCGTGCATGATGG
ACCTCAGAAGATACCCACTGGATGAGCAAAACTGCACTTTGGAAATTGAAAGCTATGGCTACACTACGGA
TGACATTGAATTTTACTGGCGTGGCGGGGACAAGGCTGTCACTGGCGTGGAAAGGATCGAGCTCCCACAG
TTCTCCATTGTAGAGCACCGTCTGGTCTCCAGGAATGTTGTCTTCGCCACAGGTGCCTATCCTCGACTTT
CATTGAGTTTTCGGTTGAAGAGAAATATCGGGTACTTCATTCTTCAGACGTATATGCCCTCAATCCTGAT
CACAATCCTCTCGTGGGTGTCCTTCTGGATCAATTACGATGCATCTGCTGCTCGAGTTGCCCTTGGGATT
ACCACCGTGCTCACCATGACAACCATCAACACTCACCTTCGGGAGACTCTACCCAAAATTCCCTATGTCA
AAGCCATCGACATGTACCTGATGGGCTGCTTTGTCTTTGTATTCCTGGCACTTCTGGAGTACGCCTTTGT
CAACTACATTTTCTTTGGAAGAGGTCCCCAAAGGCAGAAGAAGCTTGCGGAGAAGACAGCCAAGGCCAAG
AATGATCGTTCTAAGAGTGAAATAAACCGGGTGGATGCTCACGGGAATATCCTATTAGCACCGATGGATG
TTCACAATGAAATGAATGAGGTTGCAGGCAGCGTTGGTGACACCAGGAATTCAGCAATATCCTTTGACAA
CTCAGGAATCCAGTATAGGAAACAGAGCATGCCCAAGGAAGGGCATGGGCGGTACATGGGAGACAGAAGC
ATCCCGCACAAGAAGACCCACCTACGGAGGAGGTCTTCACAGCTCAAAATCAAAATCCCTGATCTAACCG
ATGTGAATGCCATAGACAGATGGTCCCGCATCGTGTTTCCATTCACCTTTTCTCTCTTCAATTTAGTTTA
CTGGCTGTACTATGTTAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001038701
Insert Size 1422 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001038701.2, NP_001033790.1
RefSeq Size 5516 bp
RefSeq ORF 1422 bp
Locus ID 14402
Cytogenetics 7 33.53 cM
Gene Summary Ligand-gated chloride channel which is a component of the heteropentameric receptor for GABA, the major inhibitory neurotransmitter in the brain (PubMed:9108119). Plays an important role in the formation of functional inhibitory GABAergic synapses in addition to mediating synaptic inhibition as a GABA- gated ion channel (PubMed:27129275). The gamma2 subunit is necessary but not sufficient for a rapid formation of active synaptic contacts and the synaptogenic effect of this subunit is influenced by the type of alpha and beta subunits present in the receptor pentamer (PubMed:27129275). The alpha1/beta3/gamma2 receptor exhibits synatogenic activity whereas the alpha2/beta3/gamma2 receptor shows very little or no synaptogenic activity (PubMed:27129275). Functions also as histamine receptor and mediates cellular responses to histamine (By similarity). Plays an important role in somatosensation and in the production of antinociception (PubMed:10670447).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains an alternate exon at its 5' end and initiates translation at an alternate start codon compared to variant 1. The resulting protein (isoform b) is the same length but has a distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.