Cdk8 (NM_153599) Mouse Untagged Clone
CAT#: MC216379
Cdk8 (untagged) - Mouse cyclin-dependent kinase 8 (Cdk8), (10ug)
"NM_153599" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cdk8 |
Synonyms | MGC37111 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC216379 representing NM_153599
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_153599 |
Insert Size | 1395 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_153599.3, NP_705827.2 |
RefSeq Size | 2586 bp |
RefSeq ORF | 1395 bp |
Locus ID | 264064 |
UniProt ID | Q8R3L8 |
Cytogenetics | 5 G3 |
Gene Summary | Component of the Mediator complex, a coactivator involved in regulated gene transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Phosphorylates the CTD (C-terminal domain) of the large subunit of RNA polymerase II (RNAp II), which may inhibit the formation of a transcription initiation complex. Phosphorylates CCNH leading to down-regulation of the TFIIH complex and transcriptional repression. Recruited through interaction with MAML1 to hyperphosphorylate the intracellular domain of NOTCH, leading to its degradation (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218219 | Cdk8 (tGFP-tagged) - Mouse cyclin-dependent kinase 8 (Cdk8), (10ug) |
USD 886.00 |
|
MR218219 | Cdk8 (Myc-DDK-tagged) - Mouse cyclin-dependent kinase 8 (Cdk8) |
USD 686.00 |
|
MR218219L1 | Lenti ORF clone of Cdk8 (Myc-DDK-tagged) - Mouse cyclin-dependent kinase 8 (Cdk8) |
USD 986.00 |
|
MR218219L2 | Lenti ORF clone of Cdk8 (mGFP-tagged) - Mouse cyclin-dependent kinase 8 (Cdk8) |
USD 986.00 |
|
MR218219L3 | Lenti ORF clone of Cdk8 (Myc-DDK-tagged) - Mouse cyclin-dependent kinase 8 (Cdk8) |
USD 986.00 |
|
MR218219L4 | Lenti ORF clone of Cdk8 (mGFP-tagged) - Mouse cyclin-dependent kinase 8 (Cdk8) |
USD 986.00 |
{0} Product Review(s)
Be the first one to submit a review