Ttll9 (NM_029064) Mouse Untagged Clone

CAT#: MC216338

Ttll9 (untagged) - Mouse tubulin tyrosine ligase-like family, member 9 (Ttll9), transcript variant 2, (10ug)

USD 598.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ttll9 (NM_029064) Mouse Untagged Clone
Symbol Ttll9
Synonyms 1700016F23Rik; 4930509O20Rik; AW046572
Vector pCMV6-Entry
Sequence Data
>MC216338 representing NM_029064
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGCGACAGAAGAATCAAAATTCCAAGGGCCATGGAGTGTCGAAAGGAAAAGAGAGAGAGCAGAGAA
CCTTAATCCGCTTCAAGACCACCCTCATGAACACACTCATGGATGTTCTGCGCCACAGGCCCGGATGGGT
GGAAGTCAAAGATGAAGGCGAATGGGATTTCTATTGGTGTGATGTCAGCTGGCTGCGGGAGAACTTTGAC
CACACCTACATGGATGAGCACGTGCGCATAAGCCACTTCCGGAACCACTACGAGCTTACCAGGAAAAACT
ACATGGTAAAGAACCTGAAGCGCTTCCGGAAGTACCTGGAGCGTGAGTCAGGAAAGACGGAGGCAGCCAA
GTGTGACTTCTTCCCCAAAACCTTTGAGATGCCCTGTGAGTACCATCTGTTTGTGGAGGAGTTTCGCAAG
AACCCCGGGATCACCTGGATCATGAAGCCTGTCGCCCGATCTCAGGGGAAGGGCATATTTCTCTTCCGGA
GACTGAAAGACATCATGGACTGGAGGAAGGGCACTTCGGGGAAGAAACCCACCGGTGTGGAGACGCAGCC
TGCTCGAGCCAACATGAACCCCTCAGGCAGCCATGACACAAGGAGTTCTGATGACCAGAAAGATGACCTC
CCGGTGGAGAACTACGTGGCTCAGCGTTACGTGGAAAACCCCTACTTAATAGGAGGCCGCAAGTTTGACC
TGCGCGTCTACGTGCTGGTGATGTCGTACATCCCTCTGCGGGCATGGCTGTACCGTGATGGCTTTGCCAG
GTTCTCCAACACCCGATTCACACTGAATAGCATCGATGACCACTATGTTCACCTCACCAATGTTGCTGTG
CAGAAGACATCGCCTGACTACCACCTAAAAAAGGGTTGCAAGTGGATGCTTCAGCGCTTCAGGCAGTACC
TGGCTTCCAAGCATGGTCCTAAGGCCGTGGAGACACTCTTCAGTGACATGGACAATATCTTCATCAAGAG
CCTGCAGAGCGTGCAGAAGGTGATCATCAGTGATAAGCACTGCTTTGAGCTCTATGGCTATGACATCCTC
ATTGACCAGGACCTCAAGCCGTGGCTCCTAGAAGTCAATGCCTCTCCTTCCCTGACGGCCAGCAGCCAGG
AGGACTATGAACTCAAGACCTGTCTGCTGGAGGATACCCTGCACGTGGTGGACATGGAGGCCAGGCTCAC
AGGAAAGGAGAAGAGAGTCGGGGGCTTCGATCTCATGTGGAATGATGGCCCTGTCAGCCGAGAGGATGGG
CCTTCTGACCTATCAGGGATGGGGAACTTTGTGACCAACACTCACCTAGGTACGTTGAGCCAGACAGGAA
GTGAGTGGGAGAGAAACATCATAGGAAGTGGAGGGGGGCTGGGGCCGCTTGGCAGAGCAGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_029064
ORF Size 1395 bp
Insert Size 1395
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_029064.2, NP_083340
RefSeq Size 1547
RefSeq ORF 1395
Locus ID 74711
Cytogenetics 2|2 H1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.