Mapk10 (NM_001081567) Mouse Untagged Clone

CAT#: MC216295

Mapk10 (untagged) - Mouse mitogen-activated protein kinase 10 (Mapk10), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mapk10
• Synonyms: C230008H04Rik; JNK; JNK3; JNK3B1; JNK3B2; p54bSAPK; p493F1; p493F12; SAPK(beta); Ser; Serk2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC216295 representing NM_001081567
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACCTTGGATGTGAAAATTGCCTTTTGTCAGGGAT
  TCGATAAACACGTGGATGTGTCATCTATTGCCAAACATTACAACATGAGCAAAAGCAAGGTGGACAACCA
  GTTCTACAGTGTGGAAGTGGGGGACTCAACCTTCACCGTTCTTAAGCGCTACCAGAACCTGAAGCCAATT
  GGCTCTGGGGCTCAGGGAATAGTCTGTGCTGCGTACGACGCTGTCCTTGACAGAAATGTGGCCATTAAGA
  AGCTCAGCAGACCCTTCCAGAACCAAACTCACGCCAAGAGGGCTTACCGGGAGCTGGTCCTCATGAAGTG
  TGTGAACCATAAAAACATTATTAGCTTATTAAATGTTTTTACACCCCAGAAAACACTGGAGGAGTTCCAA
  GATGTCTACTTAGTGATGGAACTGATGGACGCCAACCTGTGTCAGGTGATTCAGATGGAGCTGGACCACG
  AGCGGATGTCTTACTTGCTGTACCAGATGCTGTGTGGCATCAAGCACCTCCACTCCGCTGGGATCATCCA
  CAGGGACTTAAAACCCAGTAACATTGTAGTCAAGTCTGATTGCACACTGAAAATCCTCGACTTCGGACTG
  GCCAGGACAGCGGGTACAAGCTTCATGATGACTCCGTATGTGGTGACGCGATATTACAGAGCCCCTGAGG
  TCATCCTGGGCATGGGCTACAAGGAGAACGTGGACATATGGTCTGTGGGATGCATCATGGGAGAAATGGT
  TCGCCACAAAATCCTCTTTCCCGGAAGGGACTATATTGACCAGTGGAACAAAGTCATCGAGCAGCTAGGA
  ACTCCGTGTCCAGAGTTCATGAAGAAATTGCAGCCCACAGTCAGAAACTACGTGGAGAATCGGCCCAAGT
  ACGCAGGACTCACCTTCCCCAAGCTCTTTCCAGATTCCCTCTTCCCAGCGGATTCTGAGCACAATAAACT
  TAAAGCCAGCCAAGCCAGGGATTTGTTGTCTAAGATGTTAGTGATTGACCCAGCGAAGAGGATATCGGTG
  GACGACGCACTGCAGCATCCGTACATCAACGTTTGGTACGACCCGGCTGAAGTGGAGGCGCCTCCGCCTC
  AGATATATGATAAGCAGCTGGATGAAAGGGAGCACACCATCGAAGAATGGAAAGAACTTATCTACAAGGA
  GGTAATGAACTCAGAAGAGAAGACTAAGAATGGCGTAGTCAAAGGCCAGCCCTCGCCTTCAGGTGCAGCA
  GTGAACAGCAGTGAGAGTCTCCCTCCATCCTCGTCTGTCAACGACATCTCCTCCATGTCCACCGACCAGA
  CCCTCGCATCTGACACTGACAGCAGCCTGGAGGCCTCGGCGGGACCGTTGGGTTGTTGCAGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001081567
• Insert Size: 1395 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001081567.2, NP_001075036.1
• RefSeq Size: 6599 bp
• RefSeq ORF: 1395 bp
• Locus ID: 26414
• Cytogenetics: 5 E5
• Gene Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as integration points for multiple biochemical signals, and thus are involved in a wide variety of cellular processes, such as proliferation, differentiation, transcription regulation and development. This kinase is specifically expressed in a subset of neurons in the nervous system and is activated by threonine and tyrosine phosphorylation. Targeted deletion of this gene in mice suggests that it may have a role in stress-induced neuronal apoptosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2017]
  Transcript Variant: This variant (1) represents the predominant transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1, also know as JNK3 alpha2) results from translation termination at the upstream UGA stop codon, while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UGA termination codon. This RefSeq represents the shorter isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.