Foxd3 (NM_010425) Mouse Untagged Clone

CAT#: MC216257

Foxd3 (untagged) - Mouse forkhead box D3 (Foxd3), (10ug)

USD 598.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Foxd3 (NM_010425) Mouse Untagged Clone
Symbol Foxd3
Synonyms CWH3; Genesis; Hfh2
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC216257 representing NM_010425
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCCTCTCCGGCAGCGGCAGCGCCAGCGATATGTCCGGCCAGACGGTGCTGACGGCCGAGGACGTGG
ACATCGATGTGGTGGGCGAGGGCGACGACGGGCTGGAGGAGAAGGACAGCGACGCCGGGTGCGACAGCCC
CGCGGGGCCTCCGGACCTGCGCCTGGACGAGGCGGACGAAGGGCCACCGGTGAGCGCTCATCACGGCCAG
TCTCAACCGCAAGCCCTGGCACTGCCCACCGAGGCGACCGGGCCGGGGAACGACACGGGAGCTCCGGAGG
CCGACGGCTGCAAGGGCGGCGAGGACGCGGTGACAGGCGGCGGTGGGCCCGGCGCGGGCAGCGGGGCGAC
GGGAGGTCTGACCCCGAACAAGCCCAAGAACAGCCTGGTGAAGCCACCCTACTCTTACATCGCGCTCATC
ACCATGGCCATCCTGCAGAGCCCGCAGAAGAAGCTGACCCTGAGCGGCATCTGCGAGTTCATCAGCAACC
GTTTTCCGTACTACCGGGAGAAGTTCCCCGCCTGGCAGAACAGCATCCGCCACAACCTGTCGCTCAACGA
CTGCTTCGTCAAGATCCCCCGCGAGCCGGGCAACCCGGGCAAGGGCAACTACTGGACCCTGGACCCCCAG
TCCGAGGACATGTTCGACAACGGCAGCTTCCTGCGGCGCCGGAAGCGCTTCAAGCGCCACCAGCAGGAGC
ACCTGCGCGAGCAGACGGCGCTGATGATGCAGAGCTTCGGAGCCTACAGCCTGGCGGCGGCGGCGGGCGC
AGGACCCTACGGCCGCCCCTACGGCCTGCACCCCGCGGCGGCTGCGGGCGCCTACTCGCACCCCGCGGCG
GCGGCGGCGGCCGCGGCTGCTGCGGCGCTCCAGTACCCGTACGCGCTACCACCCGTGGCTCCCGTGCTGC
CGCCCGCAGTGCCCCTGCTGCCCTCGGGCGAGCTGGGCCGCAAAGCGGCCGCCTTCGGCTCGCAGCTCGG
TCCGAGCCTGCAGCTACAGCTCAACACCCTGGGCGCCGCCGCGGCAGCCGCGGGCACGGCGGGCGCGGCG
GGCACCACGTCGCTCATCAAGTCCGAGCCCAGTGCGCGGCCGTCGTTCAGCATCGAGAACATCATAGGCG
CGGGATCCGCGGCGCCCGGGGGCTCGGCTGGGGGTGGTGGGAGCGGCGGCGGAGCCGGGGGTGGCGGGGG
CAGTGGGGGCGGCGGCGGCGCGCAGTCCTTCCTGCGGCCGCCCGGGACTGTGCAGTCGGCTGCGCTCATG
GCCACGCACCAGCCCCTGTCGCTGAGCCGGACGACTGCCACCATCGCGCCCATTCTGAGCGTGCCGCTGT
CTGGACAGTTCCTGCAGCCCGCAGCCTCAGCCGCAGCGGCTGCGGCCGCCGCCGTGCAAGCCAAGTGGCC
CGCTCAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_010425
ORF Size 1410 bp
Insert Size 1410
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_010425.3, NP_034555
RefSeq Size 2373
RefSeq ORF 1410
Locus ID 15221
Cytogenetics 4 C6|4 45.71 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.