Gramd1c (NM_153528) Mouse Untagged Clone

CAT#: MC216185

Gramd1c (untagged) - Mouse GRAM domain containing 1C (Gramd1c), transcript variant 1, (10ug)


  "NM_153528" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gramd1c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gramd1c
Synonyms 4921521N14Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216185 representing NM_153528
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAACACTTGTTATCAGTTGAAGAAAATGTGCAGCCAAGAAGTCCAGGAAGAAGCAGCGTGGATGACG
CTGGGGAAAGAGATGAGAAGTTCTCCAAGGCCGTCAGCTTTACACAGGAGTCAGTTAGCAGAGCTTCAGA
AACAGAGCCATTGGACGGGAACTCACCGAAAAGAGGACTAGGAAAAGAGGATTCCCAGAGCGAGAGAAAT
GTGAGAAAAAGTCCTTCGCTAGCTTCAGAAAAGAGGATAAGCAGAGCACCCTCCAAGTCACTGGACTTGA
ATAAGAATGAGTACCTTTCTCTGGATAAAAGCAGCACTTCAGATTCTGTGGACGAAGAAAATATTCCCGA
GAAAGATCTTCAAGGAAGACTTTATATCAACCGTGTCTTTCACATCAGTGCTGAGAGAATGTTCGAACTG
CTGTTCACTAGCTCACACTTTATGCAGAGATTTGCAAATTCTAGAAATATAATAGATGTGGTATCTACCC
CCTGGACAGTTGAATCTGGAGGCAATCAGCTGCGAACCATGACCTATACCATAGTCCTCAGCAACCCGCT
AACTGGGAAGTATACTGCTGCCACAGAAAAGCAGACCCTGTATAAAGAGAGCCGGGAAGCACAGTTCTAC
CTGGTAGACTCCGAAGTGCTGACACATGATGTGCCCTATCACGACTACTTCTACACTTTGAACAGATACT
GTATCGTGAGATCTGCAAAACAGAGATGCAGGCTGAGAGTCTCCACAGACTTGAAGTACAGGAAACAACC
ATGGGGCCTTATCAAGTCTTTAATTGAGAAGAATTCCTGGAGTTCACTGGAGAGCTACTTCAAAAAGCTT
GAATCCGATTTGTTAATGGAAGAGTCTGTGTTGAGTCAATCCATTGAAGATGCTGGAAAACATAGCAGCC
TACGCCGGAGAAGGCGGACCTTGAACCGGACAGCAGAGCCCGTTCCAAAGCTGTCCTCTCAGCGCTCTTC
CACAGATTTGGGCTTCGAGGCCAAAGTAGATGTTACAGGAAAGAGAAAGACCGTGGACAGTTATGACACC
GCCCTTATTGTGGTGATGAGCATATTCTTGCTGCTGCTCGTTCTGCTGAATGTGACACTATTTCTGAAGC
TGTCAAAGATAGAACACGCTACCCAGTCCTTCTACCAGCTTCACCTCCAGGGAGAAAAATCTTTAAATTT
AGTCTCTGACAGGTTCTCAAGAACAGAAAATATTCAAAAGAACAAAGATCAGGCCCACCGCCTAAAAGGA
GTACTCCAAGATTCCATAGTGATGTTGGAACAGCTGAAGAGCTCACTCATTATGCTTCAAAAAACCTTTG
ATTTACTAAATAAGAACAAGTCTGGGGTGGCTGTGGAGAGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_153528
Insert Size 1374 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153528.2, NP_705756.1
RefSeq Size 3506 bp
RefSeq ORF 1374 bp
Locus ID 207798
UniProt ID Q8CI52
Cytogenetics 16 B4
Gene Summary Cholesterol transporter that mediates non-vesicular transport of cholesterol from the plasma membrane (PM) to the endoplasmic reticulum (ER) (PubMed:30220461). Contains unique domains for binding cholesterol and the PM, thereby serving as a molecular bridge for the transfer of cholesterol from the PM to the ER (PubMed:30220461). Plays a crucial role in cholesterol homeostasis and has the unique ability to localize to the PM based on the level of membrane cholesterol (PubMed:30220461). In lipid-poor conditions localizes to the ER membrane and in response to excess cholesterol in the PM is recruited to the endoplasmic reticulum-plasma membrane contact sites (EPCS) which is mediated by the GRAM domain (PubMed:30220461). At the EPCS, the sterol-binding VASt/ASTER domain binds to the cholesterol in the PM and facilitates its transfer from the PM to ER (PubMed:30220461).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes isoform 1. Variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.