Syt7 (NM_173067) Mouse Untagged Clone

CAT#: MC215986

Syt7 (untagged) - Mouse synaptotagmin VII (Syt7), transcript variant 2, (10ug)


  "NM_173067" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Mouse Monoclonal Anti-Synaptotagmin-7 Antibody
    • 100 ug

USD 570.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Syt7"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Syt7
Synonyms AI851541; B230112P13Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215986 representing NM_173067
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTACCGGGACCCGGAGGCGGCCAGCCCAGGGGCACCTACCCGCGATGTCCTGCTGGTCTCTGCAATCA
TCACCGTCAGCCTTAGCGTCACTATCGTCCTCTGCGGCCTGTGCCACTGGTGTCAGCGCAAACTGGGCAA
ACGCTACAAGAATTCCTTGGAGACGGTGGGCACGCCAGACTCGGGGCGTGGGCGCGGTGAGAAGAAAGCC
ATCAACGACCTAGACAGAGACTTTTGGAATAACAATGAAAGCACAGTGCAGCAGAAATGGAGTTCCTATC
CTCCCAAGGAGTTTATTCTAAACATTTCACCCTACGCCCCTTATGGCGACCCTCGACTGTCCCTCAAGTT
GCCTGCAGGAGGGAAGGCTGTGAATACAGCCCCAGTGCCCGGCCAGACGCCACACGATGAGTCTGACCGC
AGAACGGAGACCCGTTCCTCTGTCTCGGACCTCGTCAACTCCCTTACCAGCGAGATGCTCATGCTCTCCC
CGGGTTCTGAGGAGGATGAGGCCCACGAGGGCTGCAGCCGAGAGAACCTGGGCCGAATCCAGTTCAGTGT
TGGCTACAACTTCCAAGAGTCCACACTCACCGTGAAGGTCATGAAGGCCCAAGAGCTGCCAGCCAAGGAC
TTCAGCGGTACTAGTGACCCCTTTGTCAAGATCTACCTGCTACCCGACAAGAAGCACAAACTGGAGACCA
AGGTGAAGCGGAAGAATCTAAACCCGCACTGGAATGAGACCTTTCTATTTGAAGGGTTTCCCTACGAGAA
AGTGGTGCAGAGGGTCCTCTACCTCCAGGTCCTGGATTATGACCGTTTCAGCCGCAATGACCCCATTGGG
GAGGTGTCCATCCCTCTGAACAAGGTGGACCTGACCCAGATGCAGACCTTCTGGAAGGATCTGAAGCCAT
GCAGCGATGGGAGTGGGAGCCGAGGGGAGCTGCTCTTGTCCCTCTGCTACAACCCCTCTGCCAACTCCAT
CATCGTGAACATCATCAAAGCTCGAAACCTCAAAGCCATGGACATCGGGGGCACATCAGACCCCTATGTG
AAGGTGTGGCTGATGTATAAAGACAAGCGGGTAGAGAAAAAGAAGACCGTGACAAAGAAGAGGAACCTGA
ACCCCATCTTCAATGAGTCTTTCGCCTTCGACATACCCACGGAGAAGCTGAGGGAGACCACGATCATCAT
CACTGTCATGGACAAAGACAAGCTCAGCCGCAACGACGTCATCGGCAAGATCTACCTGTCCTGGAAGAGC
GGACCAGGTGAAGTGAAACACTGGAAGGACATGATCGCTCGTCCCCGGCAGCCTGTGGCCCAGTGGCACC
AGCTGAAAGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_173067
Insert Size 1344 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_173067.3, NP_775090.1
RefSeq Size 6474 bp
RefSeq ORF 1344 bp
Locus ID 54525
UniProt ID Q9R0N7
Cytogenetics 19 A
Gene Summary Ca(2+) sensor involved in Ca(2+)-dependent exocytosis of secretory and synaptic vesicles through Ca(2+) and phospholipid binding to the C2 domain. Ca(2+) induces binding of the C2-domains to phospholipid membranes and to assembled SNARE-complexes; both actions contribute to triggering exocytosis. SYT7 binds Ca(2+) with high affinity and slow kinetics compared to other synaptotagmins (PubMed:26738595). Involved in Ca(2+)-triggered lysosomal exocytosis, a major component of the plasma membrane repair (By similarity). Ca(2+)-regulated delivery of lysosomal membranes to the cell surface is also involved in the phagocytic uptake of particles by macrophages (PubMed:16982801, PubMed:21041449). Ca(2+)-triggered lysosomal exocytosis also plays a role in bone remodeling by regulating secretory pathways in osteoclasts and osteoblasts (PubMed:18539119). Involved in cholesterol transport from lysosome to peroxisome by promoting membrane contacts between lysosomes and peroxisomes: probably acts by promoting vesicle fusion by binding phosphatidylinositol-4,5-bisphosphate on peroxisomal membranes (PubMed:25860611). Acts as a key mediator of synaptic facilitation, a process also named short-term synaptic potentiation: synaptic facilitation takes place at synapses with a low initial release probability and is caused by influx of Ca(2+) into the axon terminal after spike generation, increasing the release probability of neurotransmitters (PubMed:24569478, PubMed:26738595). Probably mediates synaptic facilitation by directly increasing the probability of release (PubMed:26738595). May also contribute to synaptic facilitation by regulating synaptic vesicle replenishment, a process required to ensure that synaptic vesicles are ready for the arrival of the next action potential: SYT7 is required for synaptic vesicle replenishment by acting as a sensor for Ca(2+) and by forming a complex with calmodulin (PubMed:24569478). Also acts as a regulator of Ca(2+)-dependent insulin and glucagon secretion in beta-cells (PubMed:18308938, PubMed:19171650). Triggers exocytosis by promoting fusion pore opening and fusion pore expansion in chromaffin cells (PubMed:20956309). Also regulates the secretion of some non-synaptic secretory granules of specialized cells (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.