Glra1 (NM_020492) Mouse Untagged Clone

CAT#: MC215940

Glra1 (untagged) - Mouse glycine receptor, alpha 1 subunit (Glra1), (10ug)


  "NM_020492" in other vectors (4)

Reconstitution Protocol

USD 732.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Anti-Glycine Receptor Antibody
    • 200 ug

USD 545.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Glra1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Glra1
Synonyms nmf11; oscillator; ot; spasmodic; spd
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215940 representing NM_020492
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTACAGCTTCAATACTCTGCGATTCTACCTTTGGGAGACCATTGTATTCTTCAGCCTTGCTGCTTCCA
AAGAGGCTGAAGCCGCCCGCTCCGCACCCAAGCCTATGTCACCCTCGGACTTCCTGGATAAGCTCATGGG
GAGGACTTCTGGGTATGACGCCAGGATCAGGCCCAACTTTAAAGGTCCTCCTGTGAATGTAAGTTGCAAC
ATCTTCATCAACAGTTTCGGTTCCATCGCTGAGACAACCATGGACTATAGGGTCAACATCTTCCTGAGGC
AGCAGTGGAACGACCCCCGTCTGGCCTACAATGAATACCCTGATGACTCTCTGGACCTTGACCCATCTAT
GTTGGATTCCATCTGGAAGCCTGACTTGTTCTTTGCCAATGAGAAGGGGGCCCACTTCCACGAAATCACC
ACGGACAACAAACTGCTAAGAATCTCCCGGAATGGCAATGTCCTCTACAGCATCAGAATCACCCTGACGC
TGGCCTGCCCCATGGACCTGAAGAATTTCCCGATGGATGTACAGACGTGTATCATGCAACTCGAAAGCTT
TGGATATACCATGAACGACCTCATCTTTGAGTGGCAGGAGCAAGGAGCTGTGCAGGTGGCAGACGGACTG
ACCCTGCCTCAGTTTATTCTGAAGGAAGAGAAAGACCTGAGATACTGCACCAAGCACTACAACACAGGTA
AATTCACCTGCATCGAGGCCCGATTCCACCTGGAGCGGCAGATGGGCTACTACCTGATCCAGATGTACAT
CCCCAGCCTGCTCATCGTCATCCTGTCCTGGATCTCCTTCTGGATCAACATGGATGCTGCACCAGCTCGT
GTGGGGCTGGGCATCACCACAGTGCTCACCATGACCACACAGAGCTCTGGCTCCCGAGCCTCCCTACCCA
AGGTGTCCTACGTGAAAGCTATTGACATTTGGATGGCTGTTTGCCTGCTCTTCGTGTTCTCTGCCCTGCT
GGAGTACGCCGCCGTCAACTTTGTGTCTCGGCAACACAAGGAACTGCTTCGATTTAGGAGGAAGAGGCGA
CATCACAAGGATGATGAGGGTGGAGAAGGCCGCTTCAACTTCTCTGCCTATGGGATGGGCCCAGCCTGTC
TGCAGGCCAAGGATGGCATCTCTGTCAAGGGTGCCAACAACAACAACACCACTAACCCGCCTCCTGCGCC
ATCCAAGTCCCCGGAGGAGATGCGGAAACTCTTCATCCAGAGAGCCAAGAAGATCGACAAGATATCTCGC
ATCGGTTTCCCCATGGCCTTCCTCATCTTCAACATGTTCTACTGGATCATCTATAAGATCGTCCGGAGAG
AGGATGTCCACAACAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_020492
Insert Size 1350 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020492.4, NP_065238.2
RefSeq Size 2389 bp
RefSeq ORF 1350 bp
Locus ID 14654
Cytogenetics 11 33.12 cM
Gene Summary Glycine receptors are ligand-gated chloride channels. Channel opening is triggered by extracellular glycine (PubMed:16672662, PubMed:17114051, PubMed:24801766). Channel opening is also triggered by taurine and beta-alanine (By similarity). Channel characteristics depend on the subunit composition; heteropentameric channels are activated by lower glycine levels and display faster desensitization (By similarity). Plays an important role in the down-regulation of neuronal excitability (PubMed:9145798). Contributes to the generation of inhibitory postsynaptic currents (PubMed:16672662, PubMed:17114051, PubMed:24801766). Channel activity is potentiated by ethanol. Potentiation of channel activity by intoxicating levels of ethanol contribute to the sedative effects of ethanol (PubMed:24801766).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.