Wipi1 (NM_145940) Mouse Untagged Clone

CAT#: MC215904

Wipi1 (untagged) - Mouse WD repeat domain, phosphoinositide interacting 1 (Wipi1), (10ug)


  "NM_145940" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Wipi1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Wipi1
Synonyms 4930533H01Rik; AW411817; D11Ertd498e
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215904 representing NM_145940
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGCCGAAGCCGCAGATGCCCCTCCGGGCCGAGTGGAGGCGGCGCTCAGCTGCTTCTCTTTCAACC
AAGACTGCACATCCCTAGCGATTGGAACCAAGGCCGGTTACAAGCTGTTTTCTCTGAGTTCTGTGGAGCA
GCTTGACCAAGTCCATGGAAGCAATGAAATCCCTGACGTGTATATCGTGGAGCGCCTCTTCTCCAGCAGC
CTGGTTGTAGTGGTCAGTCACACAAAACCTCGGCAGATGAACGTCTACCATTTCAAGAAAGGCACTGAGA
TCTGTAATTACAGCTACTCCAGCAACATTTTGTCTATTCGGCTCAACCGACAGAGGCTGCTGGTCTGCCT
GGAAGAATCCATCTATATCCACAACATTAAGGATATGAAGTTATTGAAGACCGTCCTGGATATTCCCTCA
AACCCAACAGGTCTCTGTGCCCTGTCTATCAACCATTCCAACTCTTACCTGGCCTATCCTGGAAGCCAGA
GTACAGGCGAGATTGTACTCTATGATGGAAACTCCCTGAAAACGGTGTGCACCATTGCTGCCCACGAGGG
GACGCTGGCCGCTATCACCTTCAACTCCTCGGGCTCCAAGCTAGCAAGCGCGTCTGAAAAAGGCACTGTC
ATCCGAGTGTTCTCTGTTCCCGAGGGCCAGAAACTCTATGAGTTTCGTCGAGGAATGAAAAGGTATGTGA
CAATCAGCTCCCTGGTGTTCAGTATGGACTCCCAGTTCCTGTGTGCCTCCAGCAACACGGAGACCGTGCA
CATCTTCAAGATGGAACACCTGACAGACAGCCGCCCAGAAGAGCCTTCCACCTGGAGCGGCTACATGGGA
AAGATGTTCATGGCAGCTACCAACTACCTCCCCGCCCAGGTGTCGGACATGATGAACCAGGACAGGGCTT
TCGCCACAGGACGCCTGAACTTCTCTGGGCAGAAGAACATTTGCACCCTGTCCACGATCCAGAAACTGCC
GCGGTTGCTGGTGGCCTCCTCCGACGGACACCTTTACATCTACAACTTGGACCCACAGGATGGAGGAGAA
TGTGTCCTAATCAAAACCCACAGCTTGCTTAGCTCAGGAACAACAGAAGAGAACAAAGAAAATGACCTCA
GACCTTCCTTACCTCCATCTTATGCTGCAACTGTAGCAAGGCCCAGCACGTCTGCAGCCTCCACGGTGCC
AGGATACTCTGAGGACGGCGGGGCGCTCCGAGGGGAAGTTATTCCGGAACACGAGTTTGCGACGGGACCA
GTGTGTCTAGACGACGAGAATGAGTTTCCCCCTATAATCTTGTGCCGTGGAAGTCAGAAGGGCAAAACGA
AGCAGTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_145940
Insert Size 1341 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145940.2, NP_666052.1
RefSeq Size 1817 bp
RefSeq ORF 1341 bp
Locus ID 52639
UniProt ID Q8R3E3
Cytogenetics 11 72.18 cM
Gene Summary Component of the autophagy machinery that controls the major intracellular degradation process by which cytoplasmic materials are packaged into autophagosomes and delivered to lysosomes for degradation. Plays an important role in starvation- and calcium-mediated autophagy, as well as in mitophagy (By similarity) (PubMed:22275429). Functions downstream of the ULK1 and PI3-kinases that produce phosphatidylinositol 3-phosphate (PtdIns3P) on membranes of the endoplasmic reticulum once activated. Binds phosphatidylinositol 3-phosphate (PtdIns3P), and maybe other phosphoinositides including PtdIns3,5P2 and PtdIns5P, and is recruited to phagophore assembly sites at the endoplasmic reticulum membranes. There, it assists WIPI2 in the recruitment of ATG12-ATG5-ATG16L1, a complex that directly controls the elongation of the nascent autophagosomal membrane. Involved in xenophagy of Staphylococcus aureus. Invading S.aureus cells become entrapped in autophagosome-like WIPI1 positive vesicles targeted for lysosomal degradation. Plays also a distinct role in controlling the transcription of melanogenic enzymes and melanosome maturation, a process that is distinct from starvation-induced autophagy. May also regulate the trafficking of proteins involved in the mannose-6-phosphate receptor (MPR) recycling pathway (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.