Ednrb (NM_001136061) Mouse Untagged Clone

CAT#: MC215780

Ednrb (untagged) - Mouse endothelin receptor type B (Ednrb), transcript variant 2, (10ug)


  "NM_001136061" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ednrb"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ednrb
Synonyms ET-B; ET-BR; ETb; ETR-; ETR-b; Sox10; Sox10m1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215780 representing NM_001136061
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAATCGCCCGCAAGCCGGTGCGGACGCGCCTTGGTGGCGCTGCTGCTGGCCTGTGGCTTCTTGGGGG
TATGGGGAGAGAAAAGAGGATTCCCACCTGCCCAAGCCACGCTGTCACTTCTCGGGACTAAAGAGGTAAT
GACGCCACCCACTAAGACCTCCTGGACCAGAGGTTCCAACTCCAGTCTGATGCGTTCCTCCGCACCTGCG
GAGGTGACCAAAGGAGGGAGGGGGGCTGGAGTCCCGCCAAGATCCTTCCCTCCTCCGTGCCAACGAAATA
TTGAGATCAGCAAGACTTTTAAATACATCAACACGATTGTGTCGTGCCTCGTGTTCGTGCTAGGCATCAT
CGGGAACTCCACGCTGCTAAGAATCATCTACAAGAACAAGTGCATGCGCAATGGTCCCAATATCTTGATC
GCCAGTCTGGCTCTGGGAGACCTACTGCACATCATCATAGACATACCCATTAACACCTACAAGTTGCTCG
CAGAGGACTGGCCATTTGGAGCTGAGATGTGTAAGCTGGTGCCCTTCATACAGAAGGCTTCTGTGGGAAT
CACAGTGCTGAGTCTTTGTGCTCTAAGTATTGACAGATATCGAGCTGTTGCTTCTTGGAGTCGAATTAAA
GGAATTGGGGTTCCAAAATGGACAGCAGTAGAAATTGTTTTAATTTGGGTGGTCTCTGTGGTTCTGGCTG
TCCCCGAAGCCATAGGTTTTGATATGATTACGTCGGACTACAAAGGAAAGCCCCTAAGGGTCTGCATGCT
TAATCCCTTTCAGAAAACAGCCTTCATGCAGTTTTACAAGACAGCCAAAGATTGGTGGCTGTTCAGTTTC
TACTTCTGCTTGCCGCTAGCCATCACTGCAGTCTTTTATACCCTGATGACCTGCGAAATGCTCAGGAAGA
AGAGCGGTATGCAGATTGCTTTGAATGATCACTTAAAGCAGAGACGAGAAGTGGCCAAGACAGTCTTCTG
CCTGGTCCTCGTGTTTGCTCTCTGTTGGCTTCCCCTTCACCTCAGCCGGATCCTGAAGCTCACCCTGTAT
GACCAGAGCAATCCACACAGGTGTGAGCTTCTGAGCTTTTTGTTGGTTTTGGACTACATTGGTATCAACA
TGGCTTCTTTGAACTCCTGCATCAATCCAATCGCTCTGTATTTGGTGAGCAAAAGATTCAAAAACTGCTT
TAAGTCATGTTTGTGCTGCTGGTGCCAAACGTTTGAGGAAAAGCAGTCCTTGGAGGAGAAGCAGTCCTGC
CTGAAGTTCAAAGCCAACGATCACGGATATGACAACTTCCGGTCCAGCAATAAATACAGCTCGTCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001136061
Insert Size 1329 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136061.2, NP_001129533.1
RefSeq Size 4191 bp
RefSeq ORF 1329 bp
Locus ID 13618
UniProt ID P48302
Cytogenetics 14 53.05 cM
Gene Summary This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) represents the longest transcript. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.