Gm15114 (NM_001082966) Mouse Untagged Clone

CAT#: MC215762

Gm15114 (untagged) - Mouse predicted gene 15114 (Gm15114), (10ug)

USD 557.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gm15114 (NM_001082966) Mouse Untagged Clone
Symbol Gm15114
Synonyms Ott-like; OTTMUSG00000019010
Vector pCMV6-Entry
Sequence Data
>MC215762 representing NM_001082966
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAACCATGAAGACGAAATTAGACAGCTGAGATATCTAGAAGCTGCTAATTCTGAAGAAGAATACA
ATGAGGAGAATGACATACAGTCAGAAAGCTCCAGAGGGCAAGCATTTTTCCCTGGACATCCGCGAGGGAG
AGGACACAGACGTGACAGTAGGGGAAGAAATGGCCATTTTTTCAGACAAAGATTTTCAGCAAATCATCCT
CTACTTCATCTGACAAGACAAGTCAACCTAGAAAGTCTAACAAGGAGGAATGGAAACCAATCAGAAGAGA
GACAGCTACAACAAGAAAGAATCCAATTGTTCTTCAGGAGTTTACATGGCCTCTCCCAATCTCATGACCA
CCACATTGGCAGATCTCATGGCCACGATTCCAGAAGATCACGTAATCGATTCAGGAGAGCTCCTGTTCAC
TCAGAGAGATCTCATGTCTACTCAGGTAGAACTAATAACTATACAGATAGACCACACCATGACCTCTCAG
ATAGACCACACAATCAACTCTCAGTGAGACCACATCCTGACCTCTCAGGTAGACCACTTCATGACTACTC
AGGTAGACCACATCAAAACCATGCAGTTAGGCTTCAACATGGCCACTCAGATAGATATCATCTTACCCAT
ACAGAGAGAGTTCTTCCTAACAACTCAGGGATAGCTCATCCTGGCCACACAGAGAGAGATAATCAAGTCC
AAAGAGGGAGAGCTCATGATAACCAATCAGGATTAGCTCATCACAACCATGATGGCAGATCTCATCATGA
CCACTCAGGGAGAGCTTATCACGGCCATGCAAGGAGAGCTCATAACAACCAGTCATGGAGATCTGATAAC
AACCAGTCATGGAGAGATCTTAAACAGTCATGGAGAGGTCAGAACAACCAGTCACAGAGAGGTCATGACA
ACCAGTCACAGAGAGGTCATGACAACCAGTCACAGAGAGGTCATAATGATCAGTCATGGAGAGCTCATAA
CATCCGGTCACGGAGAGATCGTTATCACACCTCATTGAGATCTAGTAGCATCCAGTCATGGATGCTTCAT
GAAAGAGAAAGATACCATGGTCCAAGAGGAAGAAATGGACCAAGGGATGCATCACCACCAGGATCTGAGC
CAGAAATTGACAGATCGTCTGCAATAAGAGAAAGGACTGACTATTTATGGGTACAGGAACATCGAAGAAA
TGAGACAGTTGAACTGAATGTAGCGCTAGAAGACGGCTACAGCAGTGCTGAAGAGAGTGATGAAAGTTTT
GACAGACTAACCTGTAGCTCCATGCTAGATACACTATACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001082966
ORF Size 1302 bp
Insert Size 1302
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001082966.1, NP_001076435
RefSeq Size 1974
RefSeq ORF 1302
Locus ID 100034729
Cytogenetics X F2|X
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.