Relt (NM_177073) Mouse Untagged Clone

CAT#: MC215758

Relt (untagged) - Mouse RELT tumor necrosis factor receptor (Relt), (10ug)

USD 557.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Relt (NM_177073) Mouse Untagged Clone
Symbol Relt
Synonyms E430021K24Rik; Tnfrsf19l
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC215758 representing NM_177073
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCACTCCAGGGCCTGATGATGAAGCGGACCTTGCTGTGCTGGCCCCTGTCTTGCCTCTTTGTGCTGC
TGCCCTGGCCTCTGGCCACTCCAACACCAATAACTCCTTGGCTGTGTCCACCTGGCAAAGAGCCTGACCC
AGATCCAGGACAGGGCACATTATGCAGAACTTGCCCCCCAGGAACCTTTTCAGCCTCATGGAACTCCTAT
CCATGCCAGCCTCATTACCGATGCAGCCTTCAAAAGAGGCTGGAGGCCCAGGCTGGCACAGCAACTCATG
ATACAATGTGTGGAGACTGCCAGCATGGGTGGTTTGGGCCACAGGGAGTTCCTCATGTTCCGTGTCAGCC
ATGTTCCAAGGCACCTCCAAGTACTGGTGGCTGTGATGAGTCAGGGCGGCGGGGCCGGCGTGGCGTCGAA
GTGGCAGCAGGTACCAGTAGCAACGGTGAACCTCGGCAGCCCGGGAATGGCACTCGGGCAGGCGGTCCTG
AGGAGACGGCTGCCCAGTATGCAGTGATTGCCATCGTTCCTGTCTTTTGTCTCATGGGGCTTCTGGGCAT
CCTGGTGTGCAACCTGCTCAAGCGGAAGGGCTACCATTGCACAGCCCAAAAGGAAGTTGGGCCCAGCCCT
GGTGGAGGAGGCAGCGGGATTAATCCTGCCTATAGGACTGAAGATGCCAACGAGGACACCATTGGAGTCC
TGGTGCGCCTGATCACAGAGAAGAAAGAGAATGCAGCGGCCCTGGAGGAGCTGTTGAAAGAATATCACAG
CAAACAGCTGGTACAGACAAGTCACAGGCCTGTACCCAGGCTGCTGCCGGCCTCACCCAGCATACCCCAC
ATCTGCCCGCATCACCACCACCTGCACACTGTGCAGGGCCTGGCCTCACTCTCTGGCCCCTGTTGCTCCC
GTTGTAGCCAGAAGTGGCCAGAGGTGCTGCTGTCTCCTGAGGCAGCAGCTGCCACCACTCCTGCTCCCAC
CCTTCTGCCTACTGCATCCAGGGCTCCCAAGGCTAGTGCCAAGCCAGGACGTCAGGGCGAGATTACCATC
TTGTCTGTGGGCAGGTTCCGTGTGGCTCGTATTCCTGAGCAGCGGACCAGTTCATTGTTATCTGAGGTGA
AGACCATCACGGAGGCTGGGCCTTCAGAGGGTGATCTCCCTGACTCCCCACAGCCTGGTCTTCCCCCCGA
GCAGCGGGCACTGCTGGGAAGTGGTGGGAGCCATACTAAGTGGTTGAAGCCCCCAGCAGAGAACAAAGCT
GAGGAGAACCGCTATGTGGTCCGGCTAAGTGAAAGCAACCTGGTCATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_177073
ORF Size 1311 bp
Insert Size 1311
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_177073.6, NP_796047
RefSeq Size 2817
RefSeq ORF 1311
Locus ID 320100
Cytogenetics 7|7 E2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.