Pdk1 (NM_172665) Mouse Untagged Clone
CAT#: MC215702
Pdk1 (untagged) - Mouse pyruvate dehydrogenase kinase, isoenzyme 1 (Pdk1), nuclear gene encoding mitochondrial protein, (10ug)
"NM_172665" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Pdk1 |
Synonyms | B830012B01; D530020C15Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_172665, the custom clone sequence may differ by one or more nucleotides
ATGAGGCTGGCAAGGCTGCTGCGGGGCGGCACGAGCGTCAGGCCGCTCTGCGCCGTCCCCTGCGCCAGCC GTAGCCTGGCCTCGGCCTCGGGTTCCGGGCCGGCGTCGGAGCTTGGCGTTCCGGGCCAGGTGGACTTCTA TGCGCGCTTCTCGCCGTCGCCACTCTCCATGAAGCAGTTCCTGGACTTCGGGTCAGTGAATGCTTGTGAA AAGACCTCGTTTATGTTTCTGCGACAAGAGTTGCCTGTTAGATTGGCAAATATAATGAAAGAAATCAGCC TTCTCCCCGATAATCTTCTCAGGACCCCATCCGTACAGCTGGTGCAAAGTTGGTATATCCAAAGCCTTCA GGAGTTGCTTGATTTTAAAGACAAAAGTGCTGAAGATGCTAAAACTATTTATGAATTCACAGACACAGTG ATAAGGATCAGAAACCGGCACAATGATGTCATTCCCACCATGGCCCAGGGTGTGACTGAATACAAGGAGA GCTTCGGGGTGGATCCTGTCACCAGCCAAAATGTTCAGTACTTTTTGGATCGATTCTACATGAGTCGCAT CTCAATTAGAATGCTACTCAACCAGCACTCCTTATTGTTCGGTGGAAAAGGAAGTCCATCTCATCGAAAG CACATTGGAAGCATAAATCCAAACTGCGACGTGGTGGAGGTCATTAAAGATGGCTATGAGAACGCTAGGC GGCTTTGTGATTTGTATTATGTTAACTCTCCTGAACTTGAACTTGAAGAACTAAATGCGAAATCACCAGG ACAGACAATACAAGTGGTTTATGTACCATCCCATCTCTATCACATGGTGTTTGAACTGTTCAAGAATGCC ATGAGAGCGACCATGGAGCACCACGCGGACAAAGGCGTTTATCCCCCGATTCAGGTTCACGTCACGCTGG GCGAGGAGGATCTGACTGTGAAGATGAGTGACCGGGGAGGCGGTGTTCCACTGAGGAAGATCGACAGACT CTTCAACTACATGTACTCAACCGCACCCCGGCCTCGTGTTGAAACGTCCCGTGCTGTGCCCCTGGCTGGG TTTGGTTACGGATTGCCCATATCACGCCTCTATGCACAGTACTTCCAGGGAGACCTAAAGCTGTATTCCT TAGAGGGCTACGGGACAGATGCGGTTATCTACATTAAGGCTCTGTCGACAGAATCCGTCGAGAGACTCCC TGTGTACAATAAAGCCGCCTGGAAGCATTACAAAGCCAACCACGAGGCTGACGACTGGTGTGTGCCCAGC CGAGAGCCGAAAGATATGACCACATTCCGAAGCTCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_172665 |
Insert Size | 1299 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC027196, AAH27196 |
RefSeq Size | 3269 bp |
RefSeq ORF | 1305 bp |
Locus ID | 228026 |
UniProt ID | Q8BFP9 |
Cytogenetics | 2 C3 |
Gene Summary | Kinase that plays a key role in regulation of glucose and fatty acid metabolism and homeostasis via phosphorylation of the pyruvate dehydrogenase subunits PDHA1 and PDHA2. This inhibits pyruvate dehydrogenase activity, and thereby regulates metabolite flux through the tricarboxylic acid cycle, down-regulates aerobic respiration and inhibits the formation of acetyl-coenzyme A from pyruvate. Plays an important role in cellular responses to hypoxia and is important for cell proliferation under hypoxia. Protects cells against apoptosis in response to hypoxia and oxidative stress (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG206918 | Pdk1 (tGFP-tagged) - Mouse pyruvate dehydrogenase kinase, isoenzyme 1 (Pdk1) |
USD 886.00 |
|
MR206918 | Pdk1 (Myc-DDK-tagged) - Mouse pyruvate dehydrogenase kinase, isoenzyme 1 (Pdk1), nuclear gene encoding mitochondrial protein |
USD 686.00 |
|
MR206918L1 | Lenti ORF clone of Pdk1 (Myc-DDK-tagged) - Mouse pyruvate dehydrogenase kinase, isoenzyme 1 (Pdk1), nuclear gene encoding mitochondrial protein |
USD 986.00 |
|
MR206918L2 | Lenti ORF clone of Pdk1 (mGFP-tagged) - Mouse pyruvate dehydrogenase kinase, isoenzyme 1 (Pdk1), nuclear gene encoding mitochondrial protein |
USD 986.00 |
|
MR206918L3 | Lenti ORF clone of Pdk1 (Myc-DDK-tagged) - Mouse pyruvate dehydrogenase kinase, isoenzyme 1 (Pdk1), nuclear gene encoding mitochondrial protein |
USD 986.00 |
|
MR206918L4 | Lenti ORF clone of Pdk1 (mGFP-tagged) - Mouse pyruvate dehydrogenase kinase, isoenzyme 1 (Pdk1), nuclear gene encoding mitochondrial protein |
USD 986.00 |
{0} Product Review(s)
Be the first one to submit a review