Gm20604 (NM_001142939) Mouse Untagged Clone

CAT#: MC215669

Gm20604 (untagged) - Mouse cDNA sequence AK010878 (AK010878), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gm20604
• Synonyms: AK010878-Moap1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC215669 representing NM_001142939
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGCTTTCGGGCGAGTACGTCGGTTGTGACGGGGAGCCGCAGCGGCTACGAGTGTCCTGTGAGGCGT
  CGGGAGACGCGGACCCTCTCCAGAGCCTGTCGGCGGGCGTGGTCCGGATGAAGGAGTTGGTAGCGGAGTT
  CTTCGGGACCCTAGTGGAGCAGGACGCGCAAGGCTTGGCGGAAGATCCGGACGACGCTTTGGATGGCTCC
  CGGACCTCTGCGTGTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142939
• Insert Size: 228 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001142939.1, NP_001136411.1
• RefSeq Size: 3835 bp
• RefSeq ORF: 228 bp
• Locus ID: 100859931
• Cytogenetics: 12
• Gene Summary: This locus represents naturally occurring readthrough transcription between the neighboring AK010878 (cDNA sequence AK010878) and Moap1 (modulator of apoptosis 1) genes on chromosome 12. The readthrough transcript encodes a protein that shares sequence identity with the upstream gene product but its C-terminal region is distinct due to frameshifts relative to the downstream gene. [provided by RefSeq, Dec 2011]