Gm11937 (NM_001099346) Mouse Untagged Clone

CAT#: MC215554

Gm11937 (untagged) - Mouse predicted gene 11937 (Gm11937), (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gm11937 (NM_001099346) Mouse Untagged Clone
Symbol Gm11937
Synonyms OTTMUSG00000004963
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC215554 representing NM_001099346
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACAGGCTCCTGCTGTGGATCCTTCTCCTCCCAGAGCTGTGGAGGAGGCTGCTGCCAGCCCTGCTGCT
GCAGGGACCCCTGCTGCTGCCGCCCAGTGTCCTGCCAGACCACAGTGTGTCGCCCTGTAACCTGTGTGCC
CCACTGCACCAGGCCCATCTGTGAGCCCTGCCGCCGCCCCATCTGCTGTGACCCCTGCAGCCTGCAGCAG
GGCTGCTGTCGCCCCATCACCTGCTGCCCCACCTCTTGCACAGCTGTGGTCTGCAGGCCTTGCTGCTGGG
CCTCCACCTGCTGCCAGCCCATCTCAGTGCAGGCTCCCTGCTGCAGGCCCCCTTGCTGCCAGCCTGCTCC
CTGTCGCACCACCTGCAGGACCTCCCCATGCAACACCTGCTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001099346
ORF Size 396 bp
Insert Size 396
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001099346.1, NP_001092816
RefSeq Size 396
RefSeq ORF 396
Locus ID 100041488
Cytogenetics 11|11 D
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.