Gm3285 (NM_001101631) Mouse Untagged Clone

CAT#: MC215549

Gm3285 (untagged) - Mouse predicted gene 3285 (Gm3285), (10ug)

USD 402.00


Availability*
13 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gm3285 (NM_001101631) Mouse Untagged Clone
Symbol Gm3285
Synonyms 100041351
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC215549 representing NM_001101631
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCCTCCACCATGTCCGTCTGCTCTGACGCTCGCACCAACTCCTCCTGGCAGGTGGATGACTGCC
CAGAGAGCTGCTGTGAGCCCTGCTGCTGTGCCCCCAGCTGCTGCCAGCCCTGCTGCTGTGCTCCAGCCCC
CTGCCTGACCCTCCTCTGCACCCCAGTGAGCTGTGTGTCCAGCCCCTGCTGCCAATCTTCCTGCTGCACA
CCCTCATGCTGCCAGCAGTCTAGCTGCCAGCCAGCTTGCTGCACCTGCTCCCCCTGCCAGCAGCCCTGCT
GTGTACCTGTTTGTTGCACACCTGTCTGCTGCACACCTGTCTGTTGCAAGCCTGTCTGCTGCAAGCCTGT
GTGCTGCACACCCATCTGCTCTGGCTCCTCCTCCTGCTGCCAGCCCTCCTGCTGTGCTCCTGTGTGCTGC
AAGCCCTGCTCCAGCCTGTCCCTGCTGTGTCGCCCTGTGTGCAGACCTGCCTGCTGTGTGCCCACCTCCT
CCTGCTGTGCCTCCTCCTGCCAGCCCAGCTGCTGTGGCCCAACCTCTAGTGTGTCCCTGCTGTGCCGCCC
TGCCTGCTCCAGACAGGCCTGCTGTGGACAGAAGTCCAGCTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001101631
ORF Size 606 bp
Insert Size 606
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001101631.1, NP_001095101
RefSeq Size 664
RefSeq ORF 606
Locus ID 100041351
Cytogenetics 10 C1|10
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.