Syce1l (NM_001048145) Mouse Untagged Clone

CAT#: MC215423

Syce1l (untagged) - Mouse synaptonemal complex central element protein 1 like (Syce1l), transcript variant 1, (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Syce1l (NM_001048145) Mouse Untagged Clone
Symbol Syce1l
Synonyms 4930481F22Rik; MMRP; mmrp2; PSESS
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC215423 representing NM_001048145
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCGGAGCTGGAGCCTTTGATGGCGGAGTGGCTGGGAGCTGAGAAAGCTGAAGACACCCGAGGGC
AGGCCGCATCTCTGAATACGATGGAAGACTTGCTGGAGACAGTGAAAAAGCTACAGAAAGAGGGAAGCCT
GGAGCCCCAGATTGAGGACCTGATCCACCGCATTAATGAGCTGCAGCAAGGTCCAGCAAAGAAGAGATCC
AGTGAGGAGCTGGGAGAGGCTCAAGCACTCCAGGAAGCCATGCACAGGGAACTAGACTCCTTAAATGAAG
AGAGAGTGCACCTAGAGGAGGTCCTGCGCAAAAAGCAAGAGGCTGTGTCAATTCTCAAGAAGCATCCCCA
AGAGAGAGACAGTGACACTCCACACTTGGATGCTCAACAACTGGAGGAGAGGCTGGCGGATCTGGCAAGG
CAACACAAGGACCTCTGGGAGTTCCATGTCCTGCAGCAGCGACTGGCCCAGGAGATCAGCACGATGGAGC
ACAGGAAAGATCAGCTTCTTGCAGAGAGGACTCTGCTGCGAGCCAGGCTGGAGAAGGTGGAGCAGCGGCT
GCAGGAGGCCAGAGAGACCTGGGACAGCCCAGGGAACTGTGGGCTGAAGACAGAGCTGGAGGAATTGGAG
GGGCAGTCCCAGCGCAGCCCAGAAGCTCAGAATGATAAAGGGGAGGCTAGCCAAGAGGAACAGCATCATT
TGGAGACATCAGAAGAGTTGCCAAGGACAGGAACGCTCTGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001048145
ORF Size 744 bp
Insert Size 744
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001048145.1, NP_001041610
RefSeq Size 837
RefSeq ORF 744
Locus ID 668110
Cytogenetics 8|8 E1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.