Gm12887 (NM_001099309) Mouse Untagged Clone

CAT#: MC215383

Gm12887 (untagged) - Mouse predicted gene 12887 (Gm12887), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gm12887 (NM_001099309) Mouse Untagged Clone
Symbol Gm12887
Synonyms OTTMUSG00000008910
Vector pCMV6-Entry
Sequence Data
>MC215383 representing NM_001099309
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGTTACCTTGCTCCCTGTGGATCCTTTCTGTCTGTCTTCTGTCTTGGTGTTGTGATGCCGAGTTGC
CTGTGGCTCTGGACCCTGAGTCAGAATCAGTCCCACAACATCCAGTGATCAAGATTCAAGTAGATGTCAT
TGTAATCGTGGTTTCCATGAAAACCTCTAATGAAACACCAAAATCTGGAACTTATGGCCAGGCTCTACAG
GATGGGAAGAATAAGATGAAGGATGTGGAGAATAAAGTCCTGGATGCCTGTTCCCAACTGTGTCAGAGTC
TTGCTCAGGATCCTAAATTGCAGCATGGCTACATTGTTGTTGCATACTTTAAGGAACACCAGCTCCTGTG
TTGTTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001099309
ORF Size 360 bp
Insert Size 360
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001099309.1, NP_001092779
RefSeq Size 649
RefSeq ORF 360
Locus ID 666927
Cytogenetics 4|4 D2.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.